ID: 964827055

View in Genome Browser
Species Human (GRCh38)
Location 3:160840111-160840133
Sequence CAGTAGGAACAAATGGTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964827051_964827055 7 Left 964827051 3:160840081-160840103 CCAGAACATTTATTCTTCTAATG 0: 1
1: 0
2: 5
3: 28
4: 383
Right 964827055 3:160840111-160840133 CAGTAGGAACAAATGGTAAGTGG 0: 1
1: 0
2: 1
3: 18
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964827055 Original CRISPR CAGTAGGAACAAATGGTAAG TGG Intronic
904513709 1:31036387-31036409 CAACAGGAACAAGTGGTAAAAGG - Intronic
906866048 1:49421357-49421379 CAGTTGTAACAAATGCTACGGGG + Intronic
907798936 1:57744824-57744846 CAGTAGGAACAAAAGCTAAATGG + Intronic
908771185 1:67597886-67597908 CAGTAGGCACAAGTGGTTAGTGG + Intergenic
910412059 1:86956551-86956573 CAGAAGGAACTGATGGTGAGAGG + Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911080827 1:93928501-93928523 CAGGAGGAAGAGAGGGTAAGTGG - Intergenic
911340114 1:96625898-96625920 CAGTATAAACAAATGGTTTGTGG + Intergenic
912115296 1:106399431-106399453 CAGTACTAACAAATAGAAAGTGG - Intergenic
912314918 1:108659421-108659443 CAGTAGCTACACATGGCAAGTGG - Intronic
912468545 1:109890830-109890852 CAGTGGGAATAAATAGAAAGAGG - Intergenic
912902771 1:113670221-113670243 CAGGAGGAAGAAATGGTATATGG - Intronic
913088920 1:115463106-115463128 CAGAAGGAAAAGATGGAAAGAGG + Intergenic
916321306 1:163507518-163507540 CAGTAGTAACAAATGACAACAGG + Intergenic
917780106 1:178385748-178385770 GAGTGGGAACAAATAGTAGGAGG - Intronic
918220887 1:182435492-182435514 CACAAGGCACAAATGTTAAGTGG - Intergenic
918497132 1:185153400-185153422 CAGAAAGAATAAATGGTAAGGGG + Intronic
920048600 1:203149765-203149787 AAGTAGGAGAAACTGGTAAGAGG - Intronic
920608738 1:207416221-207416243 CAGTAGGCACATATGGCTAGTGG + Intergenic
922171593 1:223160031-223160053 CAGCAGGAACACAATGTAAGTGG - Intergenic
922237338 1:223731956-223731978 CAGTTGGAAAAAAAGGCAAGAGG + Intronic
922429731 1:225538985-225539007 CCTTAGTAACAAATGGTAGGAGG - Intronic
923406030 1:233661551-233661573 AAGGAGGCACAGATGGTAAGAGG - Intronic
924470483 1:244338830-244338852 CAGAAGCAACAAATGTTAACAGG - Intergenic
924923557 1:248656733-248656755 TTGTTGGAAAAAATGGTAAGTGG - Intergenic
1064797058 10:19024415-19024437 CTGTAGGCCTAAATGGTAAGAGG + Intergenic
1065329528 10:24580100-24580122 CAGTAGGAGCCAATTGTAACAGG - Intergenic
1065379427 10:25074750-25074772 AAGTAGGAACAACTAGTAAATGG + Intergenic
1068398435 10:56495187-56495209 CAGTGGGAACACATGGAAACAGG + Intergenic
1068418993 10:56764542-56764564 CAGTAGAAAAGAATGATAAGAGG + Intergenic
1071721748 10:88153408-88153430 CAAAAGGAAGGAATGGTAAGAGG - Intergenic
1073888420 10:108068432-108068454 CAGCAGGAAAAAATGGAAAATGG + Intergenic
1074690503 10:115999981-116000003 CAGTAGTCACAAGTGGTTAGTGG - Intergenic
1075217386 10:120548312-120548334 AAGTGAGAACAAATGGTACGTGG + Intronic
1075812646 10:125236528-125236550 CAGTAGGAGCGAATGCTGAGAGG + Intergenic
1075817783 10:125279109-125279131 CAGTCGGAAACAATAGTAAGAGG + Intergenic
1076209388 10:128628141-128628163 CAGGAAGGACAAATGGGAAGTGG - Intergenic
1078262407 11:9722719-9722741 CATAAGGAAAATATGGTAAGAGG + Intronic
1078538554 11:12194924-12194946 CAGTAGGAAAAAAGAGTATGTGG + Intronic
1078818743 11:14854180-14854202 AAGCAGGAGCAAATGGTAACAGG - Intronic
1079292579 11:19201628-19201650 TAGTTGGAACAACTGGAAAGCGG - Intronic
1080834097 11:35923874-35923896 CAGTAAGAAGAAATGGAAAAAGG - Intergenic
1082857137 11:57818038-57818060 AAGTGGGAAGAAATGGGAAGGGG - Exonic
1087560055 11:99777932-99777954 CAGGAAGAAGAAATGGTAATTGG + Intronic
1089126856 11:116182477-116182499 CAGAAGGTACACATGGTAACAGG - Intergenic
1089192371 11:116662183-116662205 CAGCAGGGACACATGGTGAGGGG + Intergenic
1090749415 11:129732807-129732829 CAGTGGGAACTATTGGGAAGGGG + Intergenic
1090842229 11:130500683-130500705 CAAAAGGGACAAATGATAAGTGG - Intergenic
1093047621 12:14467862-14467884 CAGTAGCTACAAATGGCTAGTGG + Intronic
1096574019 12:52541411-52541433 CAGTGGGAACAAAATGTCAGTGG - Intergenic
1097502063 12:60416107-60416129 CAGAAAGAACACATGGTATGGGG + Intergenic
1097962799 12:65548927-65548949 CAGAAGGAACATCTGGTCAGTGG - Intergenic
1098707794 12:73713333-73713355 CAGCAGGGAAAAATGGGAAGAGG - Intergenic
1100046692 12:90390802-90390824 AAGTAGAAATAAATGTTAAGTGG + Intergenic
1100178085 12:92053363-92053385 TAGGAAGAAGAAATGGTAAGGGG - Intronic
1100328538 12:93564914-93564936 CAGGAGGAAGAAATGGTCACTGG + Intergenic
1101302878 12:103499439-103499461 CAGTATGAACAAAGGTTGAGGGG + Intergenic
1101812156 12:108116729-108116751 CAGTAGGAACATGTGGCTAGTGG - Intergenic
1103710217 12:122907077-122907099 CAGTAGGAAACAATGGAGAGGGG + Intergenic
1105421517 13:20256508-20256530 AATTAGTCACAAATGGTAAGTGG - Intergenic
1105557088 13:21457963-21457985 ACCTAGGACCAAATGGTAAGTGG - Intronic
1108917215 13:55629819-55629841 CAGTAAGAACATATGGTATTTGG + Intergenic
1109462430 13:62679348-62679370 AAAAATGAACAAATGGTAAGTGG - Intergenic
1110268289 13:73564691-73564713 GAGTATGAACAAATGGTATGAGG + Intergenic
1114545134 14:23494417-23494439 CAGTAGGAAAAAAGGGGGAGGGG - Intronic
1114585063 14:23803869-23803891 CAGTAGTCACATATGGCAAGTGG - Intergenic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1116148911 14:41112679-41112701 CATTAGAAATAAATGGTCAGTGG + Intergenic
1116982337 14:51184881-51184903 CATTAGGGGAAAATGGTAAGGGG - Intergenic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118502980 14:66380627-66380649 CAGTTGGAACAAAAGATAATAGG - Intergenic
1120292796 14:82598092-82598114 CAGTAGGCAGTAATGGTTAGGGG - Intergenic
1120801190 14:88690596-88690618 AAGTAGGAACAACTGTTTAGAGG + Intronic
1121401968 14:93687935-93687957 CAGAAGGATCAAGTGGCAAGTGG + Intronic
1122970473 14:105150149-105150171 CAGTACCAACAGATGGTCAGAGG + Intronic
1126148904 15:45504165-45504187 CAGAAAGAACTAATGGGAAGAGG + Intronic
1126951314 15:53884813-53884835 CAGTAGGAGTAAAGGGAAAGAGG - Intergenic
1127175462 15:56350462-56350484 GAGTAGGCACTAGTGGTAAGGGG + Intronic
1131279270 15:91007613-91007635 CAGTAGGACCACCTGGAAAGTGG + Intronic
1133286387 16:4692780-4692802 CAGTACAAACACAAGGTAAGTGG + Intergenic
1133692645 16:8231316-8231338 CAATAAGAACACATGGTCAGAGG - Intergenic
1135321905 16:21502736-21502758 CATTGGGAAGAAATGGTAAAAGG - Intergenic
1135488746 16:22888714-22888736 CAGAAGGAGCAAATGGTCAGTGG - Intronic
1135622032 16:23964079-23964101 CAGTAGGCACACATGGCTAGTGG - Intronic
1135737291 16:24942309-24942331 CAGTGGGAAGTAATGTTAAGAGG + Intronic
1136333376 16:29595852-29595874 CATTGGGAAGAAATGGTAAAAGG - Intergenic
1139316338 16:66072769-66072791 CAGAAGCAACAGAAGGTAAGAGG + Intergenic
1140202103 16:72903123-72903145 CAGCAGGAACAAATGCACAGCGG - Intronic
1146625741 17:34434189-34434211 CAGTGGGAGCCAATGGTATGAGG + Intergenic
1146711916 17:35049491-35049513 CAGTAGGAAGCAATGGGAAATGG + Intronic
1147371075 17:39993482-39993504 CAGGAGGAAGGAATGGTAAGGGG - Intronic
1150005402 17:61465924-61465946 CTGTGACAACAAATGGTAAGTGG + Exonic
1153480141 18:5539927-5539949 CAATAGGAAAAAATGGAAAAAGG - Intronic
1155265645 18:24090644-24090666 AAGAAGGAAAAAATGGAAAGTGG + Intronic
1156058324 18:33039268-33039290 CAGAAGGAAGAAATGATGAGAGG + Intronic
1156202714 18:34852680-34852702 CAGGAGGAACACATGGGAGGTGG - Intronic
1157084650 18:44567144-44567166 CAGTAGAGCCAAAAGGTAAGGGG + Intergenic
1158313201 18:56181475-56181497 CTGTAGGAAGAAATGGAAAAAGG + Intergenic
1160078788 18:75703577-75703599 CAGCAGGTACAAAAGGTAAAAGG + Intergenic
926822635 2:16869949-16869971 AAGCAGGAACAAATGGTTTGGGG - Intergenic
928175335 2:29029794-29029816 CAGGAGGAACTAGTGGCAAGGGG + Intronic
932778228 2:74541960-74541982 AGGAAGGAACAAATGGTAGGTGG - Intronic
933579212 2:84105716-84105738 ATGTAGGAAAAAATGTTAAGGGG + Intergenic
935499276 2:103818550-103818572 CAGGAAGAATAAATGGCAAGAGG + Intergenic
937443533 2:121937069-121937091 CAGTAGCCACAAGTGGCAAGTGG - Intergenic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
939726744 2:145729985-145730007 CAGGATGACCATATGGTAAGGGG + Intergenic
939837326 2:147146860-147146882 CAGTGGGAACACATGGTCACAGG - Intergenic
940585446 2:155642967-155642989 TGGTAGGAACAAAATGTAAGAGG + Intergenic
941377874 2:164753199-164753221 CACTAGGAAAAAATGATAAAGGG + Intronic
941576926 2:167244405-167244427 CAGCAAGAAGAAATCGTAAGAGG + Exonic
941982062 2:171469509-171469531 GAGTAGGTAGAAATGGTACGTGG + Intronic
942254682 2:174085086-174085108 TAGGAGTAACAAATGGAAAGTGG + Intronic
944113736 2:196164581-196164603 GAGGAGGAACAAATGCTTAGCGG - Intronic
945270357 2:207932243-207932265 CAGTAGAAACAAATAGTACATGG + Intronic
945378682 2:209112370-209112392 GAGTATGAACAAATTATAAGAGG + Intergenic
945907504 2:215611830-215611852 CAGTAGGAACAAATGCTCAGAGG - Intergenic
946623915 2:221590852-221590874 CAGTAACCACATATGGTAAGTGG + Intergenic
947258293 2:228190532-228190554 CAGAGGGAACAAATGGTTACTGG + Intergenic
948708176 2:239808444-239808466 CAATAGAAAGAAATGGCAAGAGG - Intergenic
1169745817 20:8941655-8941677 CAGTAGGAACAAATGCAAGGTGG + Intronic
1169794956 20:9452024-9452046 CAGTGGGAACAAAGGCTAGGTGG - Intronic
1170365850 20:15597759-15597781 CAGTAGAAACAAAAGTTAATAGG + Intronic
1170675024 20:18471085-18471107 CAGTATAAACAAATTGTAGGTGG - Intronic
1171138749 20:22722844-22722866 CAGCAGGAACATGTGGTAATGGG - Intergenic
1171238037 20:23543899-23543921 CAGTAGAAAGGAATGCTAAGGGG + Intergenic
1171381665 20:24738265-24738287 GAGAAGGAGCATATGGTAAGAGG + Intergenic
1175422819 20:58846025-58846047 CAGCAGGGACAGAGGGTAAGTGG + Intronic
1177442068 21:21138492-21138514 CAGTAGGAATCAATGATAACTGG + Intronic
1177754636 21:25331496-25331518 CAGAAGCAACAAAGGGTATGTGG + Intergenic
1177928081 21:27244028-27244050 CAGTAAGAACACATGGAGAGTGG + Intergenic
1180061834 21:45389370-45389392 GAGAAGAAAAAAATGGTAAGTGG - Intergenic
1184998917 22:48230321-48230343 CAGTGGGAACACCTGGTCAGAGG - Intergenic
949282940 3:2367861-2367883 CAGTAGGGCCAAATGGTTAAAGG - Intronic
951790991 3:26484649-26484671 CAGTGGGAACCAAAGGTAGGTGG + Intergenic
952161754 3:30700848-30700870 CAGTTGGAACAAAGGGGAGGGGG + Intergenic
952525287 3:34203631-34203653 CAGGAGGAACAACAGGAAAGGGG + Intergenic
953493273 3:43366925-43366947 AAGGAGGAACCAATGGAAAGCGG - Exonic
954455098 3:50593443-50593465 CAGTAAGAAAAAATGAGAAGGGG - Intergenic
956035896 3:65091566-65091588 CAGAATCAAGAAATGGTAAGAGG + Intergenic
956597534 3:70984344-70984366 GAGCAGGAAGAAATGGTAAGAGG - Intronic
959099053 3:101989825-101989847 CAGTAGGAAGATAAGGTAAGAGG - Intergenic
959769003 3:110070560-110070582 CAATAGGAACAGATTGTAACTGG - Intergenic
960412658 3:117347004-117347026 CAGTAGTTACAAAAGGAAAGTGG + Intergenic
960985429 3:123276884-123276906 CACCAGGAACAAATGGGGAGTGG - Intergenic
961146411 3:124597635-124597657 CAGTAGCCACAAATGGCCAGTGG - Intronic
964827055 3:160840111-160840133 CAGTAGGAACAAATGGTAAGTGG + Intronic
968862839 4:3186151-3186173 CAGTTGTAACAAATGCTAAGTGG - Intronic
969512917 4:7629828-7629850 CAGTAGGAAGAACTGGTTTGGGG - Intronic
970078839 4:12256385-12256407 CAGCAGGAAGGAAAGGTAAGGGG - Intergenic
971297004 4:25403730-25403752 CAGCAGCCACAAATGGTTAGTGG + Intronic
972722012 4:41709116-41709138 CTGAAGTCACAAATGGTAAGTGG - Intergenic
972894361 4:43600900-43600922 CAGTAGCAATAATTGGTATGTGG + Intergenic
974010873 4:56606221-56606243 TAGTGGGAACATATGTTAAGTGG + Intergenic
976396271 4:84559113-84559135 CAGTAGCCACATATGGTTAGTGG + Intergenic
978478160 4:109156005-109156027 CTGTAGGAACAAACTCTAAGTGG + Intronic
978933149 4:114341897-114341919 GAGTAGGATTAAATGGTAAAAGG + Intergenic
978965391 4:114734729-114734751 CAGTGGGAACAGATGGTGGGAGG + Intergenic
980445025 4:132894049-132894071 CAGTAGTAGCAATTGGTCAGAGG + Intergenic
981758266 4:148165213-148165235 AAGTAGCAACAAATGTTTAGAGG - Intronic
986172731 5:5327054-5327076 CAGGAGAAATAAATGGCAAGAGG - Intergenic
987831737 5:23104305-23104327 CAGTTGGCACAATTAGTAAGTGG - Intergenic
988838016 5:35052748-35052770 CAGAAGGAAGGAATGGTGAGAGG + Intronic
989150070 5:38290533-38290555 CAGTAGTAGCAAGTAGTAAGAGG - Intronic
989178054 5:38549063-38549085 CAGTAGTAGCAAATGGGAAATGG + Intronic
991442932 5:66669969-66669991 TAGTAGGAATAAATGACAAGAGG + Intronic
991491429 5:67187552-67187574 AAGTAGGTAAAAATGGGAAGTGG + Intronic
992754884 5:79894951-79894973 CAGTAGGAAGAAATGCTTAAGGG + Intergenic
992846563 5:80755220-80755242 CAGTCGGGACAAACAGTAAGAGG - Intronic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
995330824 5:110944214-110944236 AAATAGGACCAAATGGTATGAGG - Intergenic
995449233 5:112281774-112281796 AATTAGGAATAAAGGGTAAGGGG - Intronic
996000668 5:118359213-118359235 CAGGAGGACCAAATTCTAAGAGG + Intergenic
996990786 5:129628209-129628231 CAGTGAGAACAAATGGTATTTGG - Intronic
997865602 5:137460053-137460075 AAGTAGGACTAAATGGTAAAGGG + Intronic
998731670 5:145084240-145084262 CAGTAGTTACAAAGGCTAAGAGG - Intergenic
999432947 5:151539811-151539833 CAGCAGGAACAAATGTTGAGTGG - Intronic
999587909 5:153111049-153111071 CTGTGGGAACATATGGTAACAGG + Intergenic
1000078945 5:157825657-157825679 CAGGAGGAAAAAATTGGAAGTGG - Intronic
1003411163 6:5864032-5864054 CTGTGGGAAGAAATGGGAAGAGG + Intergenic
1005479074 6:26238263-26238285 CAGTAGCCACATATGGTTAGTGG - Intergenic
1006896540 6:37475018-37475040 CAGTAGGAGCAACTGGCAAGGGG + Intronic
1012157805 6:95841457-95841479 CAGTTGTAACAAATTCTAAGTGG + Intergenic
1014654174 6:124078963-124078985 AAATAAGAACAAATAGTAAGAGG - Intronic
1014675326 6:124357402-124357424 CAGAAGGAAGCAATGGTAATTGG + Intronic
1015221621 6:130810567-130810589 CAGGAGGAATTAATGGCAAGGGG + Intergenic
1016275986 6:142353058-142353080 CAGTATGAACTCAAGGTAAGTGG + Intronic
1018504762 6:164453423-164453445 CAGTAGGGACAAATAGGAAAGGG - Intergenic
1021180764 7:17503167-17503189 CAGTAGGAATAAATTGGAAAAGG - Intergenic
1021269638 7:18569937-18569959 AAGTAGTAACAAAAAGTAAGAGG - Intronic
1022322341 7:29298691-29298713 CAGAAGGAACAAAAGGGATGAGG - Intronic
1024128006 7:46320574-46320596 CAGTAGGTACACATAGGAAGAGG + Intergenic
1025802157 7:64796492-64796514 TAGTAGGACTAAAAGGTAAGAGG + Intronic
1030147149 7:106368209-106368231 CAGTAGGAGCCAATCTTAAGGGG - Intergenic
1030623544 7:111818406-111818428 TAGTTGGAAAAAATGGAAAGAGG - Intronic
1030852929 7:114513266-114513288 CAGAACCAACAAATGGTCAGGGG + Intronic
1031444555 7:121834913-121834935 AAGTAAGAACATATGGTAATTGG + Intergenic
1031895573 7:127345064-127345086 CAGAACAAACAAATGGTTAGTGG + Intergenic
1032588582 7:133171267-133171289 CAGTAGGGACAAACACTAAGAGG - Intergenic
1033669857 7:143481493-143481515 AAGTAGGTACAAATGTAAAGAGG - Intergenic
1035175768 7:157049516-157049538 CAGTAGGAGCAAATGGGACCAGG + Intergenic
1038088050 8:24221886-24221908 CAGTAGCCACAACTGGTCAGGGG - Intergenic
1038959397 8:32502225-32502247 CAGGAGCAACAGAGGGTAAGGGG + Intronic
1039851651 8:41371984-41372006 CAGTAGGTACATATAGTTAGTGG - Intergenic
1041166081 8:55093976-55093998 CAATAGGAACAAATGATAAATGG - Intergenic
1041751475 8:61265720-61265742 CTGTAGTAACAGAGGGTAAGTGG - Intronic
1043437321 8:80247298-80247320 CAGAAGTAACAAATGGGAGGTGG + Intergenic
1049473021 8:142784650-142784672 GAGTAGGAGCACAGGGTAAGAGG - Intergenic
1049971180 9:823511-823533 CAGTGGGAACAAGTGGGTAGTGG - Intergenic
1053565857 9:39250333-39250355 AAGTATTAACAAATGGTAAGGGG + Intronic
1053831625 9:42088183-42088205 AAGTATTAACAAATGGTAAGGGG + Intronic
1054131293 9:61368705-61368727 AAGTATTAACAAATGGTAAGGGG - Intergenic
1054598921 9:67099265-67099287 AAGTATTAACAAATGGTAAGGGG - Intergenic
1055048284 9:71953634-71953656 CAGTGGGAACAAAAGTTGAGAGG - Intronic
1056833744 9:89937134-89937156 TAGTAAGAACAAATAGTGAGAGG - Intergenic
1058170960 9:101680729-101680751 CAGAAGGAATAGAAGGTAAGAGG - Intronic
1059948810 9:119440568-119440590 CAGTAGAAGCAAATGCTAGGAGG - Intergenic
1186235302 X:7501734-7501756 CAGGAGGAAAAAGTGGGAAGGGG + Intergenic
1186278045 X:7961552-7961574 CAGGAGGACCCAATTGTAAGTGG + Intergenic
1186518245 X:10183164-10183186 CAGTAGCAACCAATGATATGAGG - Intronic
1187563705 X:20427401-20427423 CTGGAGGAACAAAAGGTAAGAGG + Intergenic
1188875847 X:35429330-35429352 TAGCAATAACAAATGGTAAGGGG + Intergenic
1190404507 X:50073236-50073258 CACTAGGTAGAGATGGTAAGAGG + Intronic
1192298637 X:69877354-69877376 CAGTACGAAGAGATGGTAACAGG - Intronic
1195073645 X:101305330-101305352 CCGTAGCAACACATGGTCAGTGG - Intergenic
1195133772 X:101882047-101882069 AAGAAGGAAGAATTGGTAAGTGG - Intergenic
1195453033 X:105037101-105037123 GAGTAGGAAAAATTAGTAAGAGG + Intronic
1195836575 X:109121640-109121662 CAGGAGGAAAAATTGGTAAAGGG + Intergenic
1197171529 X:123440029-123440051 AAGTGGGAACACATGGTATGTGG + Intronic
1199697966 X:150357156-150357178 CAATAGAAACAAATGGGAAATGG - Intergenic