ID: 964828748

View in Genome Browser
Species Human (GRCh38)
Location 3:160859587-160859609
Sequence GAGTGAATACAGCTAGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964828748 Original CRISPR GAGTGAATACAGCTAGACCA GGG (reversed) Intronic
901706160 1:11074942-11074964 CAGTGAATACAAGCAGACCAAGG + Intronic
915318450 1:155042913-155042935 GAGGGAATAGAGCTAGAGGAAGG + Intronic
918589971 1:186230175-186230197 GAGGAAATACAGCTATACCAGGG - Intergenic
919024931 1:192156022-192156044 GAGTGAAGAGAGCTAGAAAAGGG + Intergenic
919110994 1:193218187-193218209 CTGGGAATACAGCTAAACCAGGG + Intronic
920784956 1:209032529-209032551 GAGTGCATTCAGCTAGATCAAGG + Intergenic
920970277 1:210737485-210737507 AAATGAATACAGATAGACAAGGG - Intronic
922275605 1:224074862-224074884 GAAAGAATAAAGCTAGAGCAGGG + Intergenic
923235099 1:232025324-232025346 GAGGGGATACAGCTGAACCATGG + Intronic
924806011 1:247362419-247362441 CAGTGAATCCAGCTACACAAAGG + Intergenic
1066179622 10:32947312-32947334 GAAAGAAAACTGCTAGACCAAGG + Intronic
1068183812 10:53558556-53558578 GAATAAATACAGGTAGACAAAGG + Intergenic
1073209184 10:101784597-101784619 GAGTGATGAAAGCAAGACCAGGG + Exonic
1076538630 10:131199186-131199208 GGGTGAGTACAGATAGGCCACGG - Intronic
1079149269 11:17883223-17883245 TAGAAAATACAGCTGGACCAGGG + Intronic
1081187820 11:40066498-40066520 TACTGAATATAGCTTGACCAGGG - Intergenic
1082167627 11:48966166-48966188 GAGTGAGTCCAGAGAGACCAGGG + Intergenic
1082235922 11:49820484-49820506 GAGTGACTCCAGAGAGACCAGGG - Intergenic
1082609433 11:55280412-55280434 GAGTGAGTCCAGAGAGACCAAGG - Intergenic
1082657258 11:55870121-55870143 GAGTGAGTCCAGAGAGACCAGGG + Intergenic
1084241249 11:67822007-67822029 GAGTGAATACATCTTGAACCAGG - Intergenic
1092885029 12:12917427-12917449 GAGTTAATGCAACTAGATCAGGG + Exonic
1093940046 12:25043166-25043188 GAGTGAATCCAGCTTCATCAAGG + Intronic
1095939656 12:47717728-47717750 GAGTGAAGACAGCCAGGCTAGGG - Intronic
1098080213 12:66776218-66776240 CAGTAAATACAGTTAAACCAGGG - Intronic
1099461240 12:82924179-82924201 GAGAGAGAACAGCTACACCATGG + Intronic
1100658346 12:96670843-96670865 AAGAGAAAACAGCTAGAACAAGG - Intronic
1102919912 12:116784213-116784235 GAGAGTACAAAGCTAGACCAAGG + Intronic
1106058906 13:26266335-26266357 GAGTGTATAGAGCAAGACAAGGG + Intronic
1106297582 13:28431005-28431027 GAATGAATACAGCTTGGCCATGG - Intronic
1109628698 13:65014431-65014453 GAGTGAAGACAGCCAGATTAAGG - Intergenic
1115334385 14:32230603-32230625 GAGGGAATAAAGCAAGTCCAAGG + Intergenic
1115457804 14:33624928-33624950 GAATGAATACAGCCAGAACTTGG + Intronic
1117829972 14:59740551-59740573 GAGTAAATAAAGCAAGACCCTGG - Intronic
1120960153 14:90117195-90117217 CAGTGTATACAGCTGGACAAAGG + Intronic
1122535090 14:102456405-102456427 GAGAGAATGCAGCAAGTCCAGGG + Intronic
1134669009 16:16040845-16040867 GAGTGAAGGCAGGGAGACCAGGG + Intronic
1140957645 16:79880444-79880466 GAGTCAATACAGGTAAAGCATGG - Intergenic
1141677646 16:85525951-85525973 GAGTCAATGCAGCCAGTCCAAGG - Intergenic
1146805234 17:35859590-35859612 GAGTGATTACAGCAGGATCATGG - Intronic
1149095868 17:52839778-52839800 GAGTGAATACAGATAGGGAATGG + Intergenic
1149866767 17:60155366-60155388 GGGTGAGTACAGCCAGTCCAGGG + Exonic
1151038537 17:70829757-70829779 CAGTGACTACTGTTAGACCAGGG - Intergenic
1151843594 17:76635310-76635332 CAGTGAATTCAGCTAGGCGAAGG - Intronic
1153634945 18:7105515-7105537 GAATAAAGACAGCTAGACCCTGG + Intronic
1155699531 18:28726306-28726328 GAGTCAATAGACCTAGACAAAGG + Intergenic
1159726227 18:71963306-71963328 TAGTGTATACAGCTAGATCAAGG + Intergenic
1165604501 19:37089568-37089590 GACTGAATACAGAGAGATCAGGG + Intronic
1167692409 19:50994502-50994524 GATTGAAGACAGCTGGAACAGGG + Intergenic
929390456 2:41463096-41463118 GAGCTAAGATAGCTAGACCAGGG + Intergenic
932535235 2:72585829-72585851 GTATGAATACATCTAGTCCAGGG - Intronic
934632092 2:95937786-95937808 CAGTGTATACAGCTATACTATGG + Intronic
935156262 2:100486197-100486219 GAGTGAAGACAGCTAGCCTGTGG + Intergenic
936832708 2:116668307-116668329 CTGTGAATTCATCTAGACCAGGG - Intergenic
937513837 2:122629798-122629820 GAGTGCATGCAGAGAGACCAAGG + Intergenic
938716151 2:134023683-134023705 GAGATAATACATCTAGAACAGGG - Intergenic
939412693 2:141851096-141851118 GACTGAAAACAACTAGAACAAGG - Intronic
941227761 2:162869215-162869237 GAGTGAATACAGCAGGACTTAGG + Intergenic
943856676 2:192803019-192803041 AAGTTAATATAGCTAGGCCAGGG - Intergenic
945521820 2:210836882-210836904 GAGTAAATACAGTTATATCATGG + Intergenic
947122432 2:226831222-226831244 CAGTGAATCCATCTAGACCTGGG + Intergenic
947948646 2:234128613-234128635 CAGTGAATTCAGCTAAGCCATGG - Intergenic
948968159 2:241400905-241400927 GGGAGAATGCAGCCAGACCAGGG - Intronic
1170364252 20:15582352-15582374 GACTGTATTCAGCTAGACCCTGG + Intronic
1172904389 20:38358139-38358161 GAGTGACTTCATCTAGAACAGGG - Intronic
1175925914 20:62471259-62471281 GAGTGGATACAGCCAGAGGAGGG + Intronic
1179649338 21:42796731-42796753 GAGGGAACACAGCGAGACGACGG + Intergenic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
952541821 3:34374833-34374855 AAATGTATACAGCCAGACCATGG - Intergenic
959679899 3:109082826-109082848 GAGGGAATAAAGCAAGAGCAAGG + Intronic
960201046 3:114837049-114837071 GAGGCAATATAGCTAGACCAGGG - Intronic
961297677 3:125899944-125899966 GAGTCAATACATCTAGAACCAGG + Intergenic
964792497 3:160465777-160465799 GAGTGAAATCATCTAGAGCAGGG + Intronic
964828748 3:160859587-160859609 GAGTGAATACAGCTAGACCAGGG - Intronic
973717680 4:53693360-53693382 GGGTGAATGCAGGGAGACCAGGG + Intronic
973734828 4:53861355-53861377 GATTTGATGCAGCTAGACCAGGG + Intronic
977778508 4:100952116-100952138 CAGTGAACACAGCTAATCCATGG - Intergenic
978335139 4:107659041-107659063 GAGTGAATACACGCAGACAAAGG - Intronic
979185671 4:117789150-117789172 AAGTGAATAAAGCTACATCAGGG - Intergenic
987097588 5:14563690-14563712 GAGTGCATAAATCTACACCAGGG - Intergenic
987751977 5:22051562-22051584 GAAAGAATACAGCGTGACCAAGG - Intronic
991281596 5:64920567-64920589 CTGTGAATCCATCTAGACCAGGG + Intronic
993834570 5:92801946-92801968 GAGTGGATACAGCTACAACAGGG + Intergenic
996421653 5:123269457-123269479 GAGGGACTACAGCAAGCCCAAGG - Intergenic
1000569379 5:162893560-162893582 GACTGAATATAGGTAGACGAGGG + Intergenic
1003081620 6:3025838-3025860 GGGTGGTTACAGCTAGGCCACGG - Intergenic
1005588504 6:27300566-27300588 CAGTAAATACACCTAGACCCTGG - Intronic
1010646922 6:78400657-78400679 GGGTGAATACAGCTAGGCTGTGG - Intergenic
1014810911 6:125884578-125884600 GAGTGAATATAGCTGAACTATGG - Intronic
1015525559 6:134172676-134172698 CAGTGAATGCAGGTAGCCCAAGG + Exonic
1017998471 6:159556156-159556178 GGATGAATACAGCTACATCATGG + Intergenic
1024009555 7:45256104-45256126 GAGAGAATGCAGATAGTCCATGG - Intergenic
1035962956 8:4157802-4157824 GACTGACTAAAGCTGGACCAAGG - Intronic
1036806753 8:11840197-11840219 CATGGAATACAGCCAGACCAGGG + Intergenic
1038699140 8:29833470-29833492 AAGTGAATATATTTAGACCATGG + Intergenic
1048328196 8:133454484-133454506 GAGTGAATTCACCTTGGCCAGGG - Intergenic
1049382616 8:142325010-142325032 GAGTGACTCCATGTAGACCACGG + Intronic
1188615047 X:32147841-32147863 GAGTGTATACAGTTAGAAAATGG - Intronic
1188645825 X:32565825-32565847 GAGTGAATACAGTTTGCCCATGG + Exonic
1188987101 X:36777697-36777719 TACAGAATACAGCCAGACCATGG - Intergenic
1197539613 X:127741253-127741275 TAGTCAATACAGTTAGACAAGGG + Intergenic
1198064487 X:133083038-133083060 TAATGAATCCAGCTAAACCATGG + Intronic
1202263529 Y:22994374-22994396 GAGTGAAAACACCTAGAAAATGG - Intronic
1202416519 Y:24628115-24628137 GAGTGAAAACACCTAGAAAATGG - Intronic
1202454268 Y:25041971-25041993 GAGTGAAAACACCTAGAAAATGG + Intronic