ID: 964829377

View in Genome Browser
Species Human (GRCh38)
Location 3:160866333-160866355
Sequence GCTAGATTTTACCAGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964829377 Original CRISPR GCTAGATTTTACCAGGCTCA TGG Intronic
900011792 1:118563-118585 TCTAACTTTTATCAGGCTCATGG - Intergenic
900027897 1:295129-295151 TCTAACTTTTATCAGGCTCATGG - Intergenic
900041851 1:474570-474592 TCTAACTTTTATCAGGCTCATGG - Intergenic
900063288 1:709548-709570 TCTAACTTTTATCAGGCTCATGG - Intergenic
903982214 1:27197345-27197367 GCTTGATGTTAACAGGCTCATGG + Intergenic
908235864 1:62146885-62146907 GCTTGATTTTTCCAGTTTCAAGG - Intronic
910474372 1:87591218-87591240 GCTATGTTTTATCAGACTCATGG - Intergenic
912041315 1:105394899-105394921 GATAGAATTTAGAAGGCTCATGG - Intergenic
922260226 1:223934573-223934595 TCTAACTTTTATCAGGCTCATGG - Intergenic
924341395 1:243037128-243037150 TCTAACTTTTATCAGGCTCATGG - Intergenic
1062848930 10:728657-728679 GCTAGAATTCTGCAGGCTCATGG - Intergenic
1063250466 10:4268402-4268424 GGCAGATTTTATCAGGCTCCGGG - Intergenic
1063320157 10:5045075-5045097 GCTAGAATTTCCCAGTCACAAGG + Intronic
1063480987 10:6376290-6376312 CCTACATTTTAACAGGATCACGG - Intergenic
1064675841 10:17759466-17759488 GCAACATTTTACCTGGCTTAAGG + Intronic
1066735076 10:38468302-38468324 TCTAACTTTTATCAGGCTCATGG + Intergenic
1070547908 10:77467010-77467032 GCTAGATTTTTCCTAGCACAGGG - Intronic
1071810608 10:89176941-89176963 GCTGGATTTAACAAGGCTTAGGG - Intergenic
1074384162 10:113003977-113003999 GCTTGATTCTCCCAGCCTCAAGG - Intronic
1076968122 11:110799-110821 TCTAACTTTTATCAGGCTCATGG - Intergenic
1080259844 11:30336425-30336447 TCTATAATTTATCAGGCTCAAGG - Intronic
1080690160 11:34549655-34549677 GTGAGCATTTACCAGGCTCATGG + Intergenic
1080760476 11:35244220-35244242 GCTAGATTTGACCAGGCTAGTGG + Intergenic
1083299091 11:61730920-61730942 GCTACATTTTCCCAGCATCAAGG + Intronic
1085756641 11:79207180-79207202 GCAGGAGTTTGCCAGGCTCAAGG + Intronic
1092476403 12:8822617-8822639 GACAGATTTTTCCAGGGTCAGGG - Exonic
1093084311 12:14849801-14849823 GCTGTATTTTACAAGGGTCATGG - Intronic
1111639630 13:90950935-90950957 GCTAGATTATACCAGTCTTGAGG - Intergenic
1117178155 14:53166106-53166128 CCTAGAGTTTTCCAGTCTCAGGG - Intergenic
1122517094 14:102316719-102316741 GCTTGATTTAACCATGCTAAAGG + Intergenic
1124128483 15:26962407-26962429 GCTAGATTTTACCAAGCTAAGGG - Intergenic
1125733081 15:41905120-41905142 GTTAGACTTTAACAGCCTCAGGG + Intronic
1125806098 15:42495119-42495141 GCTAGAGTTTTCCAGGCTCTGGG - Intronic
1133050771 16:3116050-3116072 GCTGGAATTGTCCAGGCTCAAGG + Intronic
1135545659 16:23364403-23364425 TCTAGATGTTTCCAAGCTCAAGG - Intronic
1140160432 16:72485678-72485700 TCTAAATTTTTCCAGGCTAAGGG + Intergenic
1141206856 16:81939399-81939421 GCTACTTTTTACCAGGGGCAAGG - Intronic
1142306126 16:89286719-89286741 GCTTGATTTTACAAGGGTAAGGG + Intronic
1142452555 16:90188346-90188368 TCTAACTTTTATCAGGCTCATGG + Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1145249386 17:21289150-21289172 GCCAGAATTTACCAGGCTTTAGG + Intronic
1156383045 18:36581397-36581419 GTGAGAGTTTGCCAGGCTCAGGG - Intronic
1160644932 19:180412-180434 TCTAACTTTTATCAGGCTCATGG - Intergenic
1162229115 19:9250786-9250808 GCTATATTTTACCGTGATCATGG + Intergenic
1163444144 19:17337059-17337081 GCAAGATTTTCCCTGGATCAGGG + Intronic
927951361 2:27172050-27172072 TCTAGATTTTGCCAGGCTTTTGG + Intergenic
928074462 2:28250429-28250451 GCTATATTTTACCAGAATGAAGG - Intronic
929921238 2:46173030-46173052 TCTATATTCTACCAGGCTCATGG + Intronic
934917779 2:98314213-98314235 GCTGGAGTTTACCAGGGTCAGGG + Intergenic
935047336 2:99493933-99493955 GCTAGATTTCACCAGGGTAGGGG + Intergenic
935190546 2:100774769-100774791 GCTAGATTTTAACCCGATCAGGG + Intergenic
935357590 2:102218329-102218351 GTTAGAATTTACTAAGCTCATGG + Intronic
936288060 2:111196901-111196923 GCTGCATTTTCCCAGGCCCAGGG + Intergenic
941771652 2:169351804-169351826 ACTGGATTTAACCAGGATCAGGG + Intronic
944430116 2:199624121-199624143 TCTATATTTTACCAGTTTCACGG + Intergenic
945995093 2:216429916-216429938 CCTTGTTTTAACCAGGCTCAGGG + Intronic
948283695 2:236768341-236768363 CCTAGATGATGCCAGGCTCAGGG + Intergenic
949083997 2:242133003-242133025 TCTAACTTTTATCAGGCTCATGG + Intergenic
1174866387 20:54140244-54140266 GCCAAATTCTACCAAGCTCAAGG - Intergenic
1176280583 20:64305493-64305515 TCTAACTTTTATCAGGCTCATGG + Intergenic
1177259633 21:18712937-18712959 GTCAGATTTTTCCAGGCACACGG - Intergenic
1177786680 21:25679153-25679175 GCTAGATTTTATCACTCTTAAGG - Intronic
1178584814 21:33863092-33863114 GCAAGGTGTTACCAGGCCCAGGG - Intronic
1178715883 21:34963875-34963897 GCTTGCTTGTGCCAGGCTCAGGG - Intronic
1182084827 22:27554429-27554451 GCCAGATCTTAGCAAGCTCAGGG + Intergenic
1182596264 22:31423188-31423210 GCTAGAATTTTCCAGGTACATGG + Intronic
950874816 3:16262070-16262092 GTTAGATTTAACCAGGTTTAAGG - Intronic
952020410 3:29012100-29012122 GCTTGAGTTTACAAGGCTCAGGG - Intergenic
953153184 3:40343899-40343921 GATATATTTTACCTGGCTAAAGG + Intergenic
955795385 3:62631177-62631199 CCTAAATTTTTCCAGGCTCTAGG - Intronic
956120507 3:65961281-65961303 GGTAGATAGTACCAAGCTCAAGG - Intronic
956383201 3:68687277-68687299 GTTAGAGTTTACCAGGGTCTGGG - Intergenic
963483914 3:145912161-145912183 GAAAGATTTTAACAGGCTCTGGG - Intergenic
964829377 3:160866333-160866355 GCTAGATTTTACCAGGCTCATGG + Intronic
967681821 3:192372520-192372542 GCCTGAATTTACCAGGATCAAGG - Intronic
968957466 4:3726575-3726597 GCTGAATTCTTCCAGGCTCAAGG + Intergenic
969562028 4:7955204-7955226 GCTATATTGTACCAGGCTAGGGG - Intergenic
970000113 4:11356437-11356459 GAAAGATTTGGCCAGGCTCATGG + Intergenic
970620740 4:17815465-17815487 GATAAATTTCACCAGGTTCATGG - Intronic
970644365 4:18103169-18103191 GATAGAGTTTTCCAGGCTGAGGG + Intergenic
971303958 4:25464225-25464247 CCTTGATTTGACCAGGCTGAGGG - Intergenic
971868470 4:32204391-32204413 GATATGTTTTAGCAGGCTCAGGG - Intergenic
973038376 4:45437568-45437590 TCCAGCTTTTACCAGGCTCTGGG - Intergenic
973954244 4:56047914-56047936 ACTAGATTCTCCCAGTCTCAAGG + Intergenic
974170602 4:58261714-58261736 ACTAGATCTAACCAGTCTCAAGG + Intergenic
978183759 4:105834119-105834141 GCTAAATTTTAAGTGGCTCAGGG + Intronic
978988645 4:115049206-115049228 GCCAAATTTTACCATGCTGAAGG - Intronic
979261435 4:118651245-118651267 TCTAACTTTTATCAGGCTCATGG + Intergenic
980106454 4:128592990-128593012 GTTAGATTTAACCAGCCCCAGGG - Intergenic
982283583 4:153711569-153711591 GCTAAATTTTACAATGCTAAAGG - Intronic
982745431 4:159101332-159101354 GCTGGATTGCACCAGGGTCATGG + Intergenic
983150404 4:164272092-164272114 TCTAACTTTTATCAGGCTCATGG - Intronic
987855217 5:23411975-23411997 GCAATTTTTTCCCAGGCTCAGGG + Intergenic
989293376 5:39794794-39794816 GCCAGATTTCACCCTGCTCAAGG - Intergenic
989608657 5:43270733-43270755 GCTGGATTTAACCAGAGTCATGG + Intronic
991013398 5:61907359-61907381 GCAGGATTTCACCAGGCTGATGG + Intergenic
993799384 5:92313022-92313044 GCTAGATTTCAACAGGCAAAGGG - Intergenic
995781272 5:115777935-115777957 GCTAGTTTTTTCCTGGCACATGG - Intergenic
998126666 5:139628205-139628227 GCTATATTTTACTAGGGTCAAGG - Exonic
998716955 5:144895012-144895034 GATAGATTTTGCAAGCCTCATGG + Intergenic
998991734 5:147824524-147824546 GTTTGATTATACCAGGGTCAGGG - Intergenic
1002011769 5:176288834-176288856 GCAATATTTTTCCAGGCTCATGG + Intronic
1002215997 5:177633540-177633562 GCAATATTTTTCCAGGCTCATGG - Intergenic
1002731992 5:181344359-181344381 TCTAACTTTTATCAGGCTCATGG + Intergenic
1002752539 6:129746-129768 TCTAACTTTTATCAGGCTCATGG - Intergenic
1010379290 6:75207094-75207116 GCCAGATTGTACAAGGCGCACGG + Intergenic
1011914416 6:92485989-92486011 GATAGATTTTGCAAGCCTCATGG - Intergenic
1015724450 6:136286204-136286226 TCTTCATTTTAGCAGGCTCAAGG + Intronic
1019236244 6:170616672-170616694 TCTAACTTTTATCAGGCTCATGG + Intergenic
1022299258 7:29087472-29087494 AATAGATTTTAACAGACTCAAGG + Intronic
1028043319 7:86086388-86086410 GCTAAATTTAACCAGGCTGGTGG - Intergenic
1028078695 7:86547718-86547740 GTTAGACTATACCAGGGTCAGGG + Intergenic
1028339933 7:89706050-89706072 GCTAGAATATACCATGCTCCAGG - Intergenic
1030280740 7:107772081-107772103 GCAAGAATTTATCAGGATCAAGG - Exonic
1033429848 7:141279600-141279622 GCTAGATTTTGCCTTGCTAAGGG - Intronic
1035511527 8:189925-189947 TCTAACTTTTATCAGGCTCATGG - Intergenic
1043264915 8:78253766-78253788 GCTAGATTTTACCAAGCCCTAGG - Intergenic
1047529843 8:125664813-125664835 GCCAGATGGTGCCAGGCTCAGGG + Intergenic
1050555112 9:6783106-6783128 GCTACCTTTTACCAGGGTAAAGG - Intronic
1055155842 9:73061810-73061832 TCTTTATTTTACCAGCCTCAAGG - Intronic
1062573129 9:137194620-137194642 GCCAGGCTGTACCAGGCTCAGGG - Intronic
1062756394 9:138296694-138296716 TCTAACTTTTATCAGGCTCATGG + Intergenic
1186527424 X:10261745-10261767 TCTGGATTTTACCAAGGTCAGGG + Intergenic
1190772933 X:53530006-53530028 GCAAGATTTTATCATCCTCATGG + Intergenic
1193629381 X:83863427-83863449 CTTAGATTTTTACAGGCTCATGG + Intronic
1194180495 X:90705702-90705724 GATAGATTTAACCAGGCTTGTGG + Intergenic
1198151448 X:133914335-133914357 GCTAGATATTATCAGCCCCAGGG + Intronic
1199871345 X:151901503-151901525 GCTAGATTGTTCCAGGCACTAGG - Intergenic
1200370768 X:155722170-155722192 GCTAGTATTTACAAGTCTCATGG + Intergenic
1201578809 Y:15490038-15490060 GGTAGACTTTACCCTGCTCAGGG + Intergenic
1202382901 Y:24293625-24293647 TCTAACTTTTATCAGGCTCATGG + Intergenic
1202487883 Y:25376500-25376522 TCTAACTTTTATCAGGCTCATGG - Intergenic