ID: 964830257

View in Genome Browser
Species Human (GRCh38)
Location 3:160876634-160876656
Sequence ATTGATTTACTAGAAAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 404}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964830257 Original CRISPR ATTGATTTACTAGAAAACAA TGG Intronic
903096284 1:20978087-20978109 ATTTTTTAAATAGAAAACAATGG - Intronic
906582565 1:46948261-46948283 ATTTATTTATTCAAAAACAAAGG + Intergenic
906601047 1:47129607-47129629 ATTTATTTATTCAAAAACAAAGG - Intergenic
907126130 1:52052701-52052723 AGTGATTTATTACACAACAATGG + Intronic
907791701 1:57672387-57672409 TTTTATTTTTTAGAAAACAAGGG - Intronic
908756813 1:67476434-67476456 ATTGATTTATTTGAAAAAATTGG + Intergenic
908866866 1:68557725-68557747 GTAGATGTACTAGAAAAAAAAGG - Intergenic
908964762 1:69746709-69746731 AGAGATTGACAAGAAAACAATGG + Intronic
909166729 1:72235649-72235671 ATTGACTTAATAAAGAACAATGG + Intronic
909281787 1:73765084-73765106 ATTGATTAAATGGAAAAAAATGG - Intergenic
910530905 1:88234457-88234479 ATTACTTTAGTAGAAAAGAAAGG - Intergenic
911142177 1:94516393-94516415 ATTGAATAACTAGAAATCAAAGG + Intronic
911521637 1:98936821-98936843 ATAGATTTATTAGAGGACAAGGG + Intronic
911592106 1:99760343-99760365 ATTAAATTACTAGAAAGAAAAGG - Intronic
914450960 1:147791163-147791185 ATGGATTCACTAGAACACATGGG - Intergenic
917057222 1:170996170-170996192 ATTCATTTAATAGAAGAAAATGG + Intronic
917411299 1:174762510-174762532 ATAGATGTCCTAGAAGACAAAGG - Intronic
917561283 1:176159264-176159286 ATTCATCAAATAGAAAACAAGGG + Intronic
918295028 1:183148473-183148495 ATTTAGTTACTAGATGACAAAGG - Intergenic
918778097 1:188664623-188664645 ATTGATACACAAGTAAACAATGG - Intergenic
918800636 1:188966332-188966354 ATTGATTTCCTAAAAATAAATGG - Intergenic
918922075 1:190725652-190725674 ATTGATATACTAAGAAAAAAAGG - Intergenic
918981584 1:191567538-191567560 AATTATTTAGTAGTAAACAATGG + Intergenic
919214132 1:194530090-194530112 ATTCCTTTTCTAGAAAAAAAGGG + Intergenic
919295998 1:195700853-195700875 ATTAATTTATTATAAAACATAGG - Intergenic
919417742 1:197332402-197332424 GCTGATTTCATAGAAAACAAGGG - Intronic
919524282 1:198628004-198628026 ATTCATCTAAGAGAAAACAAAGG + Intergenic
919957149 1:202429196-202429218 ATTCATTTTCTAGAACTCAAGGG - Intronic
920355951 1:205372741-205372763 CTTGCATTACTAGAAAAGAAAGG - Intergenic
920977001 1:210795734-210795756 AATGATTTATTAGAAAACTGAGG - Intronic
921173854 1:212575509-212575531 ACTGATGTAATATAAAACAATGG - Intronic
921182006 1:212638638-212638660 CTTGATTTACTGGAAATCAGAGG + Intergenic
921395462 1:214664531-214664553 ACTATTTTATTAGAAAACAAAGG - Exonic
921423903 1:214980676-214980698 ATCAATTTACTATAATACAATGG - Intergenic
921585432 1:216940895-216940917 ATTTGAATACTAGAAAACAAAGG + Intronic
923197273 1:231680565-231680587 ATGGTCTTACTAAAAAACAAGGG - Intronic
923319622 1:232817975-232817997 ATTTATTTATGAGAAAATAAGGG - Intergenic
923839380 1:237651701-237651723 ATTGATTTCCATGGAAACAATGG + Intronic
923985611 1:239378544-239378566 ATTTATATAATATAAAACAATGG + Intergenic
923999917 1:239539256-239539278 ATTGAATTACAAGAGAACAAAGG - Intronic
924102150 1:240615831-240615853 AATGACTTTCTAGAAAATAAAGG - Intergenic
1063823839 10:9870108-9870130 GTTGAGTTACTAGAAAAAGATGG + Intergenic
1063933495 10:11053051-11053073 ATTTATTTTCTGGAAAACCAAGG + Intronic
1063989632 10:11546054-11546076 ATGGTTTTACTGGAAAGCAAAGG - Intronic
1064885797 10:20110741-20110763 ATTGATGAACTAGAGAGCAAGGG - Intronic
1065061048 10:21900935-21900957 AGTGATTTTCTAGAAAACTCAGG - Intronic
1065540724 10:26764279-26764301 TTTCATTTACTAAAAATCAAGGG + Intronic
1065568813 10:27046632-27046654 TTAGAATTACTAGAAAACATTGG - Intronic
1066682740 10:37949808-37949830 ATTGATTTGGGAGAAAACAAAGG + Exonic
1068453026 10:57217708-57217730 AGTAATTTACTATACAACAATGG - Intergenic
1068588526 10:58828542-58828564 ATTGATAGTCTAGAGAACAAAGG - Intronic
1068732291 10:60373117-60373139 ATTGTTTTATTAGAAAATGATGG - Intronic
1068823515 10:61406982-61407004 CTTGAATTACAAGAAAAAAAGGG - Exonic
1069239852 10:66125881-66125903 ATTGATTTACCAGTCAAAAAAGG - Intronic
1069357396 10:67602666-67602688 ATTAACTTACTTAAAAACAAAGG + Intronic
1071758803 10:88576807-88576829 ATCAATTTATTAGAAAAAAATGG - Intronic
1072133334 10:92518145-92518167 CTTCATTTAGTAGAAAAGAAAGG - Intronic
1073504949 10:103977238-103977260 ATAAATTTATTAGAAAACAAAGG + Intronic
1074338672 10:112604667-112604689 AGTCTATTACTAGAAAACAAAGG + Intronic
1074550912 10:114441570-114441592 ATTAATTTACTAGGCAACCAGGG + Intronic
1074718093 10:116238517-116238539 ATGGAATTTCTAGAGAACAAGGG + Intronic
1077809001 11:5618676-5618698 ATTAATCTACTATAAAACAATGG + Intronic
1078223669 11:9372908-9372930 ATTGTTTTCCTAGAAAATGAAGG + Intergenic
1078742118 11:14076635-14076657 GTTGCTTTGCTAGAAAGCAATGG - Intronic
1078774267 11:14380107-14380129 ATTGTTGTAGTAGAAAAAAATGG + Intergenic
1079429263 11:20373080-20373102 ATTGTTTTATTAGCAATCAATGG - Intronic
1080180749 11:29423242-29423264 CTTGATTTAACTGAAAACAAGGG - Intergenic
1080368497 11:31607939-31607961 ATTGACTTACTGCAAAAAAAAGG - Intronic
1080589464 11:33709005-33709027 ATTCATTCACTAGAATACACAGG + Exonic
1082566213 11:54681754-54681776 ATTTACTCACTGGAAAACAATGG - Intergenic
1084781285 11:71411084-71411106 GTTGATTTAAAACAAAACAAAGG - Intergenic
1087237460 11:95736025-95736047 AATGATTTCCTACAAAACAGTGG + Intergenic
1087416444 11:97862137-97862159 ATTGTGTTACTGGAAAACCAGGG + Intergenic
1087862674 11:103180933-103180955 ATTAATTTGCTATGAAACAATGG + Intronic
1089004507 11:115079727-115079749 ATAGATTAACAAGAAAACAGAGG - Intergenic
1089226604 11:116928913-116928935 ATCGATTTAATAGAAGAAAAAGG + Intronic
1090253728 11:125268581-125268603 ATTGATTGACTTGGAAGCAAGGG - Intronic
1090759140 11:129820469-129820491 TTTGTTTTACTAAAAAGCAATGG + Intronic
1091019075 11:132082448-132082470 ATTGATTTTTTAGAAGACTAAGG - Intronic
1093376243 12:18431284-18431306 AATGATTAACAATAAAACAAAGG + Intronic
1094223010 12:28014529-28014551 ATTTACTCACTAGAGAACAAAGG + Intergenic
1095052782 12:37568900-37568922 ATTAATTTGCTAGAATAAAATGG - Intergenic
1095598360 12:43985060-43985082 AATCATTTGATAGAAAACAATGG + Intronic
1095772714 12:45979392-45979414 ATGGATTTAATAGGAAAAAAGGG + Intronic
1096060542 12:48695216-48695238 CTGGATTTAGGAGAAAACAATGG + Intronic
1096682760 12:53267939-53267961 TTTGGGTTACTAGAAAAAAAGGG - Intergenic
1097008684 12:55937230-55937252 ATTGCTTTAGGATAAAACAAGGG + Intronic
1097444626 12:59654438-59654460 ACTTCTTTACTTGAAAACAAAGG - Intronic
1097574889 12:61380237-61380259 ACTGAGCTACTAGACAACAATGG - Intergenic
1097718516 12:62994790-62994812 ATTGAATCATCAGAAAACAAAGG + Intergenic
1097778265 12:63672693-63672715 ATTGTTTTACTAAAAGACAAAGG - Intergenic
1097906223 12:64922165-64922187 TTTGATTTACTAGAATACTTTGG + Intergenic
1097932800 12:65208395-65208417 ATTCAGTCACTAGAAAACTAGGG - Intronic
1098033663 12:66280509-66280531 ATAAATTTATTAGAAACCAAAGG + Intergenic
1098702150 12:73642797-73642819 ATTCTTTTGTTAGAAAACAAAGG - Intergenic
1099537404 12:83861565-83861587 CTTGATTTTCTATAAAATAAAGG - Intergenic
1100169698 12:91960064-91960086 ATTGAATTATTAAAAGACAAGGG - Intergenic
1102364177 12:112317584-112317606 ATTAGTCTACTGGAAAACAAAGG + Intronic
1105027683 12:132860064-132860086 ATATATTTAGAAGAAAACAAAGG + Intronic
1105227437 13:18449283-18449305 GTTGATTTTCTAGGTAACAACGG - Intergenic
1105329293 13:19400041-19400063 ATTGATTTACCAGAAAAGGATGG + Intergenic
1105862560 13:24429224-24429246 ATTGACTTACCAGAAAAGGATGG - Intronic
1108780610 13:53826573-53826595 ATTGATATAATAAATAACAATGG - Intergenic
1109332460 13:60946383-60946405 ATTTATTTTCTTGAAACCAAAGG + Intergenic
1109590334 13:64471325-64471347 ACTGATTTTCCAGGAAACAAGGG + Intergenic
1109646666 13:65266904-65266926 TATGATTTTCTAGAAAACAGTGG - Intergenic
1109718011 13:66242430-66242452 ATTGGTTTACTTGGACACAAAGG - Intergenic
1110483841 13:76015214-76015236 ATTGAATTAGTGGAAACCAAAGG + Intergenic
1111128583 13:83944400-83944422 AATGTCTTACAAGAAAACAATGG - Intergenic
1111410241 13:87867027-87867049 TTTGATTTAATAGAACACCATGG - Intergenic
1111634516 13:90886700-90886722 ATCTATTTACTAGTAAACAAAGG - Intergenic
1111818740 13:93187989-93188011 ATTTATTTGCTAGAAAGAAAGGG + Intergenic
1112427282 13:99314294-99314316 TTTGATCTCCTTGAAAACAATGG + Intronic
1112448836 13:99491189-99491211 ATTGGTATACTGGAAAACCAGGG - Intergenic
1112700936 13:102007093-102007115 ATCAATTTTCTAGAAAACAAAGG + Intronic
1113187452 13:107705098-107705120 TTTGATATACAAGAAAACAGAGG + Intronic
1114011890 14:18377736-18377758 GTTGATTTTCTAGGTAACAACGG - Intergenic
1115064886 14:29245978-29246000 ATTTATATAATAAAAAACAATGG - Intergenic
1115164545 14:30433170-30433192 TTTCATTTGCAAGAAAACAAAGG - Intergenic
1115192609 14:30761670-30761692 AGTGATTTAGTAGCAAAAAAAGG + Intergenic
1115588236 14:34836623-34836645 ATTGTATTACTAGAAAATAAAGG - Intronic
1116321348 14:43468382-43468404 AGTGATTCACTAGAATGCAATGG + Intergenic
1118382818 14:65231391-65231413 TTTGATTTAAAAGAATACAATGG + Intergenic
1119410681 14:74428182-74428204 ATTGAATTATAAGAAAGCAAAGG - Intergenic
1119981323 14:79084743-79084765 ATTGATTTTTTTAAAAACAAAGG + Intronic
1120149399 14:81016705-81016727 ATTGATCTTGAAGAAAACAATGG - Intronic
1120457958 14:84756071-84756093 ATTGATTTTATTGAAAACATAGG + Intergenic
1122616223 14:103019797-103019819 CTTGATGCTCTAGAAAACAATGG + Intronic
1202831606 14_GL000009v2_random:40656-40678 ATTTCTTTAAAAGAAAACAAAGG + Intergenic
1125561499 15:40637322-40637344 ATTAATTTACAAAAAAAAAAAGG - Intronic
1126169243 15:45680714-45680736 ATGGATTTATTAGAAATTAATGG - Intronic
1126224404 15:46253617-46253639 ATTTATATAATAGTAAACAATGG + Intergenic
1126456730 15:48870556-48870578 ATCCATTAATTAGAAAACAAGGG + Intronic
1126553675 15:49962583-49962605 ATAGATCTAATAGAAAATAAGGG + Intronic
1126812640 15:52423241-52423263 TTTGTTTGACAAGAAAACAATGG + Intronic
1127352351 15:58165993-58166015 TCTGATGTACAAGAAAACAAAGG - Intronic
1127804045 15:62502305-62502327 ATGGAGTTGCTAGAAAACAAAGG + Intronic
1127871536 15:63078028-63078050 TTTGCTTTACCAGAAACCAAAGG - Intergenic
1129915855 15:79270441-79270463 ATTGTATACCTAGAAAACAAAGG + Intergenic
1133630151 16:7612592-7612614 ATTTTTTTATTAGAAGACAAGGG - Intronic
1138540787 16:57686112-57686134 TTTGTGTTACTAGAATACAAAGG + Intronic
1138913068 16:61426575-61426597 ATTGGTTTACTGGTACACAAAGG + Intergenic
1140088499 16:71817789-71817811 ATTACTTGAGTAGAAAACAATGG - Intergenic
1140453404 16:75089747-75089769 ATTCATGTCCTAGAAAAAAAAGG - Intronic
1141276289 16:82591256-82591278 ATTGATTTATAAGAAAAAAAGGG - Intergenic
1143189046 17:5028207-5028229 ATTAATTTCCAAGAAAACCAAGG - Exonic
1144427702 17:15159566-15159588 ATTGATTCACTAGAAAATGAAGG - Intergenic
1144429316 17:15175824-15175846 ATTCATTTATGAGAAAACTAGGG - Intergenic
1145373299 17:22324835-22324857 ATTAATTTGCTAGAATAAAATGG - Intergenic
1145399331 17:22518111-22518133 GTTCATTTTCCAGAAAACAAGGG + Intergenic
1146564749 17:33902854-33902876 ATTGATTTCCTAGAAATTGATGG - Intronic
1147289325 17:39429017-39429039 ATTGATTTAAAAAAAAAAAAAGG + Intronic
1148250944 17:46079651-46079673 AGTGATTTACTGAATAACAAGGG - Intronic
1149023052 17:51992199-51992221 TTTGCTTTACTATAAAAAAAAGG + Intronic
1149179688 17:53919890-53919912 ATTGGTTTACTACAAAACCAGGG + Intergenic
1150495523 17:65605180-65605202 TTTGATTTGTTAAAAAACAAAGG - Intronic
1150964257 17:69949585-69949607 ATTGATTTAAGACATAACAAGGG + Intergenic
1153516545 18:5908328-5908350 ATTGTTTTTATAGGAAACAAGGG - Intergenic
1153543131 18:6178606-6178628 TTTGATAAACTAGAAAACAAAGG + Intronic
1155556731 18:27028221-27028243 ATTGAGTTACTAAAAATAAAAGG - Intronic
1155833811 18:30552954-30552976 ATTGATATACTTTAAAACCAGGG + Intergenic
1155891461 18:31275806-31275828 ATTGATATTCTAGAGAAAAATGG + Intergenic
1156129028 18:33946057-33946079 ATTTTTTTAGTTGAAAACAATGG - Intronic
1156566879 18:38201545-38201567 ATTGATTGACTTGGCAACAAGGG - Intergenic
1158257362 18:55566974-55566996 GTAGATCTACTAGAAAAGAATGG + Intronic
1159745634 18:72231174-72231196 TTTTATTTAATAGAAAACAAAGG + Intergenic
1163993757 19:21023637-21023659 ATTTATTTTCTACAAAAAAATGG - Intronic
1164914175 19:32037285-32037307 ATGTATTTCCAAGAAAACAATGG + Intergenic
1167804531 19:51771503-51771525 GTTGATTTATTTCAAAACAAAGG - Intronic
1202641092 1_KI270706v1_random:87099-87121 ATTTCTTTAAAAGAAAACAAAGG - Intergenic
925554001 2:5108653-5108675 ATTCACTTAATACAAAACAAAGG - Intergenic
925660987 2:6202416-6202438 ATTGATTTGCCACAAAAGAAAGG + Intergenic
926835406 2:17013696-17013718 AGTGACTTATTAGGAAACAATGG + Intergenic
926923782 2:17965998-17966020 GGTGATTTACTTGAAAAAAAAGG - Intronic
927023604 2:19042909-19042931 ATTGCTTTACTTGAAGAGAACGG - Intergenic
927396896 2:22662613-22662635 CTTTATCTATTAGAAAACAATGG - Intergenic
927759275 2:25737357-25737379 TTTGATTTAGGAGCAAACAATGG + Intronic
928142871 2:28745761-28745783 ATTGATTTACTAGCAAAACGAGG - Intergenic
928643906 2:33331195-33331217 ATTAATAAAATAGAAAACAAAGG - Intronic
929080394 2:38116660-38116682 TTTGATTTGCCAGGAAACAAAGG + Intergenic
929386321 2:41411574-41411596 AGTGATTTATTACATAACAAAGG - Intergenic
930627322 2:53712414-53712436 ACTGATTTTGTAGAAATCAAAGG + Intronic
930794341 2:55372039-55372061 ATTTATTTAAAAGAAAAAAAAGG - Intronic
931653529 2:64489646-64489668 ATTGATTTTCTAGAAGGGAAGGG + Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932817964 2:74876772-74876794 ATTTATTTACAAGAGAAAAAAGG - Intronic
932868569 2:75373502-75373524 ATTGGTGTACTGGAAAGCAATGG - Intergenic
933094276 2:78158186-78158208 ATTGATATCCTTGCAAACAAAGG - Intergenic
933143438 2:78822020-78822042 ATTGACTTAAAAGAAAACATTGG + Intergenic
933306578 2:80607703-80607725 ATACATTTATTAGAGAACAAAGG + Intronic
933861643 2:86475295-86475317 ATTGGTTTATTTTAAAACAAAGG + Intronic
935389807 2:102538948-102538970 ATTGATTTCTTAGAACACAGAGG - Intergenic
935551337 2:104460244-104460266 ATTTACTTCCTAGAAAACCAAGG + Intergenic
936630277 2:114194558-114194580 ACTGATTTACTTGAAAGGAAAGG + Intergenic
936831290 2:116651342-116651364 ATTGATTTTAGAGAAAATAAAGG - Intergenic
938372159 2:130776972-130776994 CTTTATTTATTACAAAACAAAGG + Intergenic
938525044 2:132121558-132121580 GTTGATTTTCTAGGTAACAATGG + Intergenic
939107641 2:137967934-137967956 TTTGATTGAATAGAAAACCAAGG - Intronic
939731596 2:145791320-145791342 TTTGCTGTTCTAGAAAACAAGGG - Intergenic
939950319 2:148464208-148464230 ATTTATTTCCTAAAAACCAAGGG - Intronic
940541510 2:155025974-155025996 ATTGTTTTCCTGGAAAACAAGGG - Intergenic
940623965 2:156149488-156149510 ATAGATTTAATAGAAACCAGAGG + Intergenic
942284456 2:174401039-174401061 GTTGACTTACTAGAAAAATATGG + Exonic
943072376 2:183155465-183155487 ATGGACTTTCTAGAGAACAACGG - Intronic
943248017 2:185480801-185480823 AGTGATTTACTTGAGAAAAATGG - Intergenic
943403428 2:187447817-187447839 ATTTATTTTCTAGAATACCATGG + Intronic
943723335 2:191228163-191228185 ATTGGTTTCCTTGAGAACAATGG + Intergenic
944253511 2:197600846-197600868 TTTGATGTATTAGAAAACAAAGG + Intronic
944385783 2:199163152-199163174 ATAGATTAACTCGAAAACAGTGG - Intergenic
944884871 2:204052327-204052349 ATTGCATGACTAGATAACAATGG - Intergenic
944993048 2:205260005-205260027 ATTGAACCACTAGAAAGCAAAGG + Intronic
946343234 2:219086251-219086273 TTTTATATACAAGAAAACAAAGG + Intronic
948151058 2:235745092-235745114 ATTTTTTTTCCAGAAAACAAGGG - Intronic
948158754 2:235806957-235806979 ATTCAACTACTAGAAACCAATGG - Intronic
948256997 2:236575848-236575870 ATTTATTTACGAGCAAACACTGG - Intronic
1169601874 20:7270348-7270370 ATTGATCTATTACAAAACTAGGG + Intergenic
1170084858 20:12517712-12517734 AGTGATTGACTAGAAAAGACAGG - Intergenic
1171248196 20:23629954-23629976 TTTCATTTACTGGAAATCAAGGG + Intronic
1171529492 20:25843488-25843510 ATTAATTTGCTAGAATAAAATGG + Intronic
1171547334 20:26012392-26012414 ATTAATTTGCTAGAATAAAATGG - Intergenic
1171888199 20:30677312-30677334 ATTTCTTTAAAAGAAAACAAAGG - Intergenic
1172739449 20:37154250-37154272 ATTGATTTAAAAAAAAACTATGG + Intronic
1173789536 20:45818928-45818950 ATTGAATTCCTACAAGACAAAGG + Intergenic
1174527202 20:51182505-51182527 GTTGGTTTACAAGAAAAAAATGG - Intergenic
1176610794 21:8885488-8885510 ATTTCTTTAAAAGAAAACAAAGG + Intergenic
1176771482 21:13078295-13078317 GTTGATTTTCTAGGTAACAACGG - Intergenic
1178018758 21:28384497-28384519 ATTGATTGTCTATAAAGCAATGG + Intergenic
1179450616 21:41466096-41466118 GTCGTTTTACAAGAAAACAATGG - Exonic
1180360866 22:11894773-11894795 ATTTCTTTAAAAGAAAACAAAGG + Intergenic
1180436382 22:15308544-15308566 GTTGATTTTCTAGGTAACAACGG - Intergenic
1183002239 22:34870476-34870498 AATGATTGAGTAGCAAACAATGG + Intergenic
1183525659 22:38321042-38321064 ATAGATTTACTAAACATCAAGGG + Intronic
951739902 3:25910013-25910035 ATGGAGTTAGTAGAAAATAATGG - Intergenic
952052041 3:29395637-29395659 AATGATTCACTTGAAAACAATGG - Intronic
954084245 3:48231433-48231455 ATTAATTAATTAGAAAAAAATGG + Intergenic
955107892 3:55917190-55917212 ACTGATTTACTAGAAGCCAGTGG - Intronic
955130996 3:56168396-56168418 ATTGCTTTACTAGAAAAACTGGG + Intronic
956055431 3:65293605-65293627 ATTCCATTACTAGAAAAGAAGGG + Intergenic
958069267 3:88588557-88588579 ATTTATTTATTATTAAACAATGG + Intergenic
958624209 3:96603872-96603894 ATTCATTCAATAGAAAACGAGGG - Intergenic
958875616 3:99613374-99613396 ATAGATATACAAGAAAAGAATGG + Intergenic
959821684 3:110742252-110742274 ATTGATAAAAAAGAAAACAAAGG + Intergenic
960599726 3:119444424-119444446 ATTCATTTTGTAGAAAACAAGGG + Intronic
960873265 3:122272356-122272378 ATGTATGTACTAGAGAACAAGGG - Intronic
961092068 3:124121763-124121785 TTTGCTTTACTGTAAAACAAAGG + Intronic
961516092 3:127437652-127437674 ATGTATTTACTAGAAACCAGGGG - Intergenic
963165079 3:142193258-142193280 ATTAATTTTTTAGAAAACAAAGG + Intronic
963332821 3:143934583-143934605 AGTAATTTACTATCAAACAAGGG + Intergenic
963714569 3:148788216-148788238 ATTCATTAACAAGTAAACAAAGG + Intergenic
963817750 3:149851668-149851690 AATGATGTACTAGAAATTAAGGG - Intronic
964418776 3:156478843-156478865 ATTGATTTTCTAAGAAATAAGGG - Intronic
964830257 3:160876634-160876656 ATTGATTTACTAGAAAACAATGG + Intronic
966616943 3:181923685-181923707 ATTGATATATTAGGGAACAATGG - Intergenic
967597849 3:191348868-191348890 ATTCATTTACTACAGAACAAAGG - Intronic
967640615 3:191858286-191858308 ATGCATGTTCTAGAAAACAACGG + Intergenic
967798362 3:193624725-193624747 GTTGATTTATTATAAATCAAAGG - Intronic
967944591 3:194793273-194793295 ATTGATAAACTAGAAAACCTAGG - Intergenic
1202737473 3_GL000221v1_random:20292-20314 ATTTCTTTAAAAGAAAACAAAGG + Intergenic
970506600 4:16736523-16736545 ATGGCTTTACTAGAAAACAATGG + Intronic
971517494 4:27506616-27506638 TTTGACTTACTAGAAAACATGGG + Intergenic
972181599 4:36473695-36473717 AGTAATCTATTAGAAAACAAGGG + Intergenic
972933489 4:44103955-44103977 TTTAAGTTACCAGAAAACAAAGG - Intergenic
972935581 4:44131064-44131086 ATTAATTTAATAGAAAACATGGG - Intergenic
973701530 4:53542216-53542238 ATTGAGTTTCCAGAAAACCAGGG + Intronic
973790858 4:54376719-54376741 ATTGATTTATTAGGAATCTAAGG - Intergenic
973831821 4:54769025-54769047 CTTCAGGTACTAGAAAACAAAGG - Intergenic
973848667 4:54938976-54938998 ACTGTTTTACCAGAAAAAAAAGG + Intergenic
974081263 4:57215698-57215720 AATGTTTTAGAAGAAAACAAAGG + Intergenic
975126591 4:70789146-70789168 ATTGCTGTTCTAGAAAACCATGG + Intronic
975327375 4:73074650-73074672 TTTGATTTACTTGACAACCAAGG + Exonic
976037084 4:80836871-80836893 ATTGAGTGACTACAAAATAAAGG - Intronic
977264923 4:94842409-94842431 ATAGATTTTCTAGAAAACCATGG + Intronic
977486738 4:97658286-97658308 ATTCATCTACTAGAGGACAATGG - Intronic
977841613 4:101713581-101713603 ATTGATTTCCCAGCTAACAAGGG - Intronic
978041729 4:104072727-104072749 ATTTATTCATTAGAACACAACGG - Intergenic
978647668 4:110957734-110957756 AGTGTTTTACTAGAATGCAATGG + Intergenic
979633064 4:122924842-122924864 AATGATTTTCTAGAAAAATAAGG + Intronic
980327087 4:131360230-131360252 ATTGAATTTCTAGAACACATTGG - Intergenic
980470586 4:133245758-133245780 ATTCTTTTACTTTAAAACAAAGG - Intergenic
981130372 4:141151907-141151929 ATTGATTTACCAGATAGCTATGG + Intronic
981345117 4:143665837-143665859 TTTGATATCCTAGAACACAAGGG - Intronic
981673634 4:147315450-147315472 ATTTATTTAATAGACGACAAAGG + Intergenic
982030196 4:151293160-151293182 ATACATTTAATAGAAAATAAGGG + Intronic
982349239 4:154396774-154396796 ATTCATTTATTTGAATACAAAGG + Intronic
982951868 4:161708747-161708769 AATTATGTATTAGAAAACAATGG + Intronic
983287499 4:165758438-165758460 ATTGGTTTACAAAAATACAATGG - Intergenic
984786534 4:183572382-183572404 ACTAATTTACCAGAAAAGAAAGG - Intergenic
1202768458 4_GL000008v2_random:172952-172974 ATTTCTTTAAAAGAAAACAAAGG - Intergenic
986837211 5:11651841-11651863 ATTGACTTCCAAGATAACAATGG - Intronic
986982398 5:13464221-13464243 ATGGATTTAAAAGAAAAAAAAGG + Intergenic
987954975 5:24727460-24727482 CTTGAGTTACTGGAAAAAAATGG + Intergenic
987980055 5:25072837-25072859 ATTGATTTCTTTGAAATCAATGG + Intergenic
988234706 5:28526959-28526981 ATTTATTTAATAAAAAAGAAAGG + Intergenic
988663080 5:33294850-33294872 ATAGATCTACTAAAAAAGAATGG + Intergenic
988733410 5:33996156-33996178 GTTGATTTAATAAAAAAAAAAGG + Intronic
989050811 5:37317914-37317936 ATTACTTGAATAGAAAACAATGG - Intronic
989512780 5:42307734-42307756 ATTCAGTTACTATAATACAATGG - Intergenic
989774038 5:45181403-45181425 ATTTATTTATTAACAAACAAGGG - Intergenic
990400062 5:55429219-55429241 AGCCATTTAGTAGAAAACAATGG + Intronic
990641990 5:57796798-57796820 ATTAAAATACTAGACAACAATGG - Intergenic
990764545 5:59167714-59167736 ATTAAGTTAATAGAAAACAGAGG - Intronic
991441787 5:66658429-66658451 ATTGATTTAAAAGGAAAGAAGGG - Intronic
991606901 5:68411803-68411825 ATTCATTTCCTAGAAAATAACGG + Intergenic
992427763 5:76675725-76675747 AGTGACTTACTAGAAAACAAAGG + Intronic
992607106 5:78469394-78469416 TTTGAATTCCTAGAAAAAAATGG + Intronic
992704675 5:79378767-79378789 ATTGATTGGCAAGGAAACAAGGG - Intronic
993216600 5:85031681-85031703 ATTGAATCATCAGAAAACAAAGG + Intergenic
993567804 5:89496716-89496738 AGTGATTTACTAGACAACTTTGG - Intergenic
994082331 5:95721061-95721083 ATTGATTTAATATAAAAATAAGG - Intronic
994475791 5:100267191-100267213 ATAGAATTATTAGGAAACAATGG + Intergenic
994732235 5:103505887-103505909 ATTGAGTTACCAGAAAACCAGGG - Intergenic
994789834 5:104209647-104209669 ATTGATTGTCTAGCTAACAATGG + Intergenic
995262699 5:110123708-110123730 ATTTTTTTATTAGAAAAAAATGG + Intergenic
996218427 5:120896950-120896972 ATTGATTTACTAAAGAAAATTGG + Intergenic
996622775 5:125529758-125529780 AGATATTGACTAGAAAACAATGG - Intergenic
996868699 5:128160428-128160450 ATTTACTTACCAGAAAAAAATGG + Intronic
997596665 5:135111683-135111705 ATTGACTTACTAGGAAAGCAGGG + Intronic
998563253 5:143191992-143192014 ATGGATCTACCAGAAACCAAGGG - Intronic
998909967 5:146948559-146948581 ATATATTAAGTAGAAAACAAAGG + Intronic
999527949 5:152428784-152428806 ATTTATTTAATAGGAAACAAGGG - Intronic
1000743521 5:165000548-165000570 CTTCATTTACAACAAAACAAAGG + Intergenic
1000793955 5:165641373-165641395 ATTTATCTACTTGAAAACAGAGG - Intergenic
1001236652 5:170035425-170035447 ATTGATTTTCTAGAATGCCAAGG + Intronic
1003870011 6:10394529-10394551 ATTGATTTATTTGAAACCAGAGG + Intronic
1004209180 6:13620394-13620416 ACTTATTTACTAGAAAAGAAAGG - Exonic
1005241043 6:23827241-23827263 TTTTATAAACTAGAAAACAATGG - Intergenic
1006038037 6:31229434-31229456 ATTGACTTACTACAATAAAAGGG + Intergenic
1006555412 6:34861907-34861929 ATCAATTTACTAGAATATAATGG - Intronic
1007453281 6:41956723-41956745 ATTGTTGTAATATAAAACAATGG + Intronic
1008857454 6:56107198-56107220 ATTAAATTACTAGAAACCAAGGG + Intronic
1009523234 6:64711179-64711201 TTTGATTTACAAGAAAATAAAGG + Intronic
1009808401 6:68631470-68631492 ATTGAAGTACTAAAAAATAAAGG - Intergenic
1011007730 6:82666263-82666285 GTTTATTAATTAGAAAACAAGGG + Intergenic
1011092109 6:83615237-83615259 ATAGATTTAACAAAAAACAAGGG + Intronic
1012330597 6:97980617-97980639 ATAGATTGAGTAGAAAACATAGG + Intergenic
1012721386 6:102750634-102750656 ATTGATATTCTAGAAAAGAGGGG - Intergenic
1012737553 6:102969302-102969324 ATTAATTTTCTAGAAAACTGTGG - Intergenic
1013893852 6:115060942-115060964 AATCATTTACTTGAAGACAAAGG - Intergenic
1014578997 6:123111061-123111083 GTAGAATTACTAGAAAAGAAGGG + Intergenic
1014657326 6:124124097-124124119 ATTGATTTTCTACAAAATAATGG + Intronic
1015464400 6:133532716-133532738 ACTGATTTACAGGAAAACAATGG + Intergenic
1015694622 6:135966370-135966392 CTAGTTTTACTAAAAAACAAAGG + Intronic
1016860360 6:148711888-148711910 ATAAACTTACTAGAAAACAGGGG - Intergenic
1017363311 6:153602867-153602889 ACAGATTTAATAGAAAACCAGGG + Intergenic
1017423893 6:154300826-154300848 ATTGTTATATTTGAAAACAATGG + Intronic
1017587324 6:155941274-155941296 ATTAGTTTACCAGAAAACAATGG - Intergenic
1018360661 6:163064084-163064106 ATTGATTTAAAAAAAAAAAAAGG - Intronic
1019090985 6:169533420-169533442 AGTGACTAAATAGAAAACAATGG + Intronic
1020601419 7:10279135-10279157 TTTGCTTTAAGAGAAAACAATGG - Intergenic
1021151436 7:17155935-17155957 ATTGATCCAACAGAAAACAAAGG + Intergenic
1021383461 7:19997980-19998002 ATTGTTTCACTATAATACAAAGG - Intergenic
1021723639 7:23529787-23529809 ATTTATTTAATAGAAATAAAGGG - Intronic
1021871004 7:25005986-25006008 ATTTCTTTAACAGAAAACAATGG + Intergenic
1021938397 7:25654002-25654024 ATTGATTTTCTAGAGAAGCAGGG + Intergenic
1022076622 7:26977635-26977657 GCTGATTTACCATAAAACAAAGG + Intronic
1022701608 7:32765786-32765808 GTTGCTTTACTAAAAGACAAAGG - Intergenic
1022937194 7:35190360-35190382 ATTGTTTTACTAAAAGACAAAGG - Intergenic
1023771499 7:43560673-43560695 ATTTATATACTTTAAAACAAAGG + Intronic
1023775511 7:43602245-43602267 ACTGAAATATTAGAAAACAAAGG - Intronic
1023849679 7:44143345-44143367 ATTTCTTTTCTAGATAACAAAGG - Intergenic
1024978086 7:55132143-55132165 ATTGATTTTTTAAAAAACATGGG + Intronic
1026430032 7:70336418-70336440 ATTGAAATAATAGAAAACATAGG - Intronic
1026518795 7:71096952-71096974 CTTGATATACTTGAAATCAAAGG + Intergenic
1027870538 7:83701283-83701305 AATAATTTATTAGGAAACAAGGG + Intergenic
1028027343 7:85861844-85861866 ATTGATTTACTTGAGAGAAAAGG + Intergenic
1028095874 7:86759840-86759862 ATTCTTTTACTAGAGAAAAAGGG - Intronic
1028167841 7:87559525-87559547 ATTAATTTAATAGAAAATAAAGG - Intronic
1028274447 7:88836219-88836241 ATTTATCTACTAGAAAATGAAGG - Intronic
1028372930 7:90115239-90115261 ATTGTTTTACTAAAAGACAAAGG + Intergenic
1029833357 7:103283002-103283024 ATTGTTTTACTAAAAGACAAAGG - Intergenic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1030453311 7:109741167-109741189 ATTAATTTAGGAGAACACAAAGG + Intergenic
1030534832 7:110753159-110753181 GTTGATTTACAAAAAAGCAATGG - Intronic
1030623667 7:111819657-111819679 TTTAATTTACTTGAAAACAGAGG + Intronic
1030837192 7:114303568-114303590 AGAGATTAACTAGGAAACAAAGG - Intronic
1031445111 7:121844437-121844459 ACTGATGTCCTAGCAAACAATGG - Intergenic
1031633046 7:124067037-124067059 ATTGTTTATCTGGAAAACAATGG + Intergenic
1031896071 7:127349178-127349200 ATTGAATTACTCTAAAACATTGG - Intronic
1033952090 7:146797297-146797319 ATTGAATTACAAAATAACAAGGG + Intronic
1035812311 8:2503129-2503151 AAAGATTTAATAGAAGACAAAGG + Intergenic
1035879176 8:3225668-3225690 ATTGATTTAAAAGAAACAAAGGG + Intronic
1037278586 8:17209499-17209521 ATGGATTTACTTAAAAACAAAGG + Intronic
1037969514 8:23162089-23162111 ATTGATTTTCTTTTAAACAAGGG - Intronic
1039873131 8:41564159-41564181 AATAATTAACTAGACAACAAGGG + Intergenic
1040025495 8:42778232-42778254 ATTTATTTAACACAAAACAAAGG + Intronic
1042248669 8:66733851-66733873 ACTGATTTATTTGAAAACAAAGG + Intronic
1042727721 8:71895274-71895296 ATGGATTTTCTAAAGAACAAAGG + Intronic
1042748902 8:72136727-72136749 ATTGATTTATAACAAAACACTGG + Intergenic
1043158281 8:76814311-76814333 TTTCATTTACCAGAAAACCAAGG - Intronic
1043292162 8:78616071-78616093 ATTGCCTTAGTAGAAAAAAAAGG + Intergenic
1043804701 8:84657307-84657329 TTTCTTTTACTAAAAAACAAAGG + Intronic
1044082412 8:87901826-87901848 ATAGATGGACTAGAAAAGAAAGG + Intergenic
1044786646 8:95800907-95800929 ATTGCTTTACAAAAAAAAAAAGG - Intergenic
1045768809 8:105709205-105709227 AATGATTTACTTTAAATCAAAGG - Intronic
1046086445 8:109442707-109442729 ATTGATTTTCTAGAAAACCATGG - Intronic
1046837962 8:118824168-118824190 ATTGTCTTACTAGAATAAAAAGG + Intergenic
1047564263 8:126024479-126024501 ATTGCTTTACTTGAAACCAGGGG - Intergenic
1047905860 8:129472464-129472486 ATTAATTTTCTAGCAAAAAATGG - Intergenic
1048150687 8:131890659-131890681 ATTAATTCAAAAGAAAACAAAGG + Intergenic
1049334232 8:142074144-142074166 AATGATTAAATAGAAAACAAGGG + Intergenic
1050395623 9:5191937-5191959 ATTGATTTAGTAAAGAAGAAAGG + Intergenic
1050466614 9:5932332-5932354 ATTTATTTTCTAGAAGAAAATGG + Intronic
1050518295 9:6469217-6469239 ATTGATTTAATAACAAATAAGGG + Intronic
1050738897 9:8796792-8796814 ATTTATTTTCTAGAAAATAAAGG + Intronic
1050830939 9:10011758-10011780 AATGTTTTAATAGAAAACTAAGG - Intronic
1050918174 9:11163552-11163574 TTTGGTTTAATAGAAAATAATGG + Intergenic
1051226274 9:14902525-14902547 ATTGCTTTACTGGAAAATATTGG - Intronic
1051899421 9:22023241-22023263 ATTGGTTTACCTGAAAAAAATGG - Intronic
1052242048 9:26284864-26284886 AATGATCAACAAGAAAACAAAGG - Intergenic
1052355250 9:27497893-27497915 TTTGATTTACTAAAAATCAGTGG - Intronic
1052358670 9:27530154-27530176 GTGGATTTACTAGAACACACTGG + Intergenic
1052896812 9:33754985-33755007 TTTGTTTTACTAAAAAGCAATGG + Intronic
1053660255 9:40269941-40269963 AATTATTTAAAAGAAAACAAAGG + Intronic
1053797468 9:41739786-41739808 ATTAATTTGCTAGAATAAAATGG + Intergenic
1054185880 9:61951838-61951860 ATTAATTTGCTAGAATAAAATGG + Intergenic
1054372387 9:64416242-64416264 AATTATTTAAAAGAAAACAAAGG + Intergenic
1054467468 9:65506204-65506226 ATTAATTTGCTAGAATAAAATGG - Intergenic
1054524343 9:66106278-66106300 AATTATTTAAAAGAAAACAAAGG - Intergenic
1054652625 9:67636681-67636703 ATTAATTTGCTAGAATAAAATGG - Intergenic
1054680005 9:67905940-67905962 AATTATTTAAAAGAAAACAAAGG + Intergenic
1054985828 9:71261121-71261143 ATTGATTTACTTGAAAGTGATGG - Intronic
1055215450 9:73854717-73854739 ATTGCTTTACTAGAAAAACATGG + Intergenic
1055253838 9:74342629-74342651 ATTAATGAAATAGAAAACAAAGG + Intergenic
1055410278 9:76021597-76021619 ATTGATTTCCTAGAGAACAGGGG - Intronic
1055479470 9:76695711-76695733 ATTGAATGAATAGAAAAGAAAGG - Intronic
1056315598 9:85386585-85386607 ATTGACTGACTACAAAACAAGGG + Intergenic
1057439006 9:95068659-95068681 AATGATTTTCAACAAAACAAAGG - Intronic
1057539564 9:95953645-95953667 ATTCATTTATTAAAAAAGAAAGG + Intronic
1057931962 9:99201451-99201473 GTTTATTTACAGGAAAACAAAGG - Intergenic
1059626798 9:116075591-116075613 ATTAATTTACGGGAAAAGAAAGG + Intergenic
1059974326 9:119699567-119699589 ATTTATTCACTAGAAGACAGGGG - Intergenic
1062403922 9:136384725-136384747 ATTGAATTAATAGAAAAATATGG - Exonic
1203706200 Un_KI270742v1:50736-50758 ATTTCTTTAAAAGAAAACAAAGG + Intergenic
1185571459 X:1137932-1137954 ATTGTTTTACCTGAAAAAAATGG - Intergenic
1185963523 X:4573445-4573467 ATTGATATAGTAGAAAAAAATGG + Intergenic
1186644536 X:11492411-11492433 ATTTCTATACTAGAAAAGAATGG + Intronic
1187280061 X:17851597-17851619 ATTGATTGGCTAGCAATCAATGG - Intronic
1189658619 X:43274404-43274426 ATGAAATTACTAGAAAACATAGG - Intergenic
1190826789 X:54025184-54025206 AAAGAATTACTAGAAAAAAATGG - Intronic
1194546262 X:95238751-95238773 ATTGAATTATCAGAAAGCAAAGG - Intergenic
1194769634 X:97885982-97886004 ATTATTTTAAAAGAAAACAATGG + Intergenic
1196135776 X:112208223-112208245 AGTGATTTATTAAAAAACAGAGG - Intergenic
1196137824 X:112229173-112229195 ATTTATTGAGTAGAAGACAATGG - Intergenic
1196242442 X:113358234-113358256 ATTCATATACTTTAAAACAATGG + Intergenic
1197607525 X:128601535-128601557 ATTCATTTACTACAAATTAATGG - Intergenic
1197801840 X:130358232-130358254 ATTCATTTAATAGAATACTATGG - Intronic
1198339719 X:135702059-135702081 ATAGATTTATAAGAAAAGAATGG - Intergenic
1199030834 X:142997518-142997540 ATAGATTTACTACCAAACAAGGG - Intergenic
1199160836 X:144609039-144609061 ATTTATTTACTAAAAACAAATGG - Intergenic
1199217115 X:145272773-145272795 ATTCATCTCCTAGAAAAGAAAGG + Intergenic
1199568070 X:149237850-149237872 AAAGATTTACAAGAAAACACAGG + Intergenic
1199880085 X:151967207-151967229 ATTGACATGCTAGAAAAGAAGGG + Intronic
1200352079 X:155508197-155508219 ATTAATTGACTGGAAAACTAAGG + Intronic
1201365393 Y:13200291-13200313 TATGATTTACTAGAAACCAAAGG + Intergenic
1202328028 Y:23713232-23713254 ATTGCTTTGGTAGAAAAAAAAGG + Intergenic
1202542742 Y:25956820-25956842 ATTGCTTTGGTAGAAAAAAAAGG - Intergenic
1202602599 Y:26609562-26609584 ATTGATTTACCAGAAAAGGATGG - Intergenic