ID: 964831155

View in Genome Browser
Species Human (GRCh38)
Location 3:160885766-160885788
Sequence AATCTGCGCAGCTCCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 2, 1: 8, 2: 16, 3: 40, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964831155_964831160 27 Left 964831155 3:160885766-160885788 CCAACCCTGGAGCTGCGCAGATT 0: 2
1: 8
2: 16
3: 40
4: 191
Right 964831160 3:160885816-160885838 TTAAGCCTGCGGAGCTCCCCTGG 0: 1
1: 0
2: 8
3: 37
4: 117
964831155_964831163 30 Left 964831155 3:160885766-160885788 CCAACCCTGGAGCTGCGCAGATT 0: 2
1: 8
2: 16
3: 40
4: 191
Right 964831163 3:160885819-160885841 AGCCTGCGGAGCTCCCCTGGGGG 0: 1
1: 0
2: 2
3: 8
4: 147
964831155_964831161 28 Left 964831155 3:160885766-160885788 CCAACCCTGGAGCTGCGCAGATT 0: 2
1: 8
2: 16
3: 40
4: 191
Right 964831161 3:160885817-160885839 TAAGCCTGCGGAGCTCCCCTGGG 0: 1
1: 1
2: 0
3: 20
4: 144
964831155_964831162 29 Left 964831155 3:160885766-160885788 CCAACCCTGGAGCTGCGCAGATT 0: 2
1: 8
2: 16
3: 40
4: 191
Right 964831162 3:160885818-160885840 AAGCCTGCGGAGCTCCCCTGGGG 0: 1
1: 0
2: 1
3: 19
4: 218
964831155_964831159 16 Left 964831155 3:160885766-160885788 CCAACCCTGGAGCTGCGCAGATT 0: 2
1: 8
2: 16
3: 40
4: 191
Right 964831159 3:160885805-160885827 CTGCAATCTGCTTAAGCCTGCGG 0: 2
1: 1
2: 10
3: 23
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964831155 Original CRISPR AATCTGCGCAGCTCCAGGGT TGG (reversed) Intronic
900766829 1:4511549-4511571 CATCTGCGGGGCTCCAGGGAAGG + Intergenic
902101736 1:13996256-13996278 AATCTGCGCGGCTCGGGGGTTGG - Intergenic
906693178 1:47806390-47806412 AGTCTGAGCAGCACCAGGCTTGG - Intronic
906954220 1:50359022-50359044 AATCTGCGTGGCTCCGTGGTTGG - Intergenic
907403460 1:54239791-54239813 AAGCTGCTCAGCTGCAGGGGTGG - Intronic
911276582 1:95867528-95867550 CAGCTGGGGAGCTCCAGGGTAGG - Intergenic
912495134 1:110086712-110086734 ACACTGCACAGCTCCAGGGTGGG - Intergenic
912624771 1:111197862-111197884 AGTCTGCTCAGCTCCACGGCTGG - Intronic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
916169799 1:161993426-161993448 AAGCTGTGCAACTCCAGGGCAGG + Intronic
917059086 1:171017466-171017488 AATCTGTGCAGCTCCGTGTTTGG - Intronic
918168680 1:181974893-181974915 AATCTGTGCAGGTCCGGGATTGG - Intergenic
919978119 1:202626070-202626092 AATGTGAGAAGCTCCAGGGAAGG + Intronic
920900499 1:210105933-210105955 AATCTGCTCAGCTTCTGGGGAGG - Intronic
923175546 1:231460972-231460994 AATGTACACAGCTCCATGGTAGG - Intergenic
1063359022 10:5433468-5433490 AATCTACTCAACTCCAGGGCAGG - Intronic
1064142065 10:12798975-12798997 AAAATGCCCAGCTCCACGGTGGG + Intronic
1065370062 10:24975217-24975239 AAACAGCACAGCTCAAGGGTGGG + Intergenic
1067085979 10:43238381-43238403 ACACTGAGCAGCTCAAGGGTAGG - Intronic
1069370890 10:67746742-67746764 AATCTGCACAGCTCTGTGGTTGG - Intergenic
1070960221 10:80493949-80493971 AATGTCTGCAACTCCAGGGTTGG + Intronic
1071043465 10:81342639-81342661 AGTTAGGGCAGCTCCAGGGTTGG - Intergenic
1072022000 10:91410961-91410983 AATCTGCGCGCCTCCAAGGCAGG - Intronic
1079425982 11:20342715-20342737 AATCTGCATGGCTCCATGGTTGG - Intergenic
1079935311 11:26609024-26609046 AATCTATGCAGCTCCATGGTTGG + Intronic
1081340212 11:41918160-41918182 AATCTGCGCAGCTCCATGGTTGG + Intergenic
1082785753 11:57315562-57315584 ATTCTGGGCAGCTCTAGGGCCGG - Intronic
1084291410 11:68171868-68171890 AGGCTGTGGAGCTCCAGGGTAGG - Intronic
1084577519 11:69999158-69999180 CATCTGCTCAGCTTCTGGGTAGG + Intergenic
1085942591 11:81222775-81222797 AATCTGCACAGCTCCATGATTGG + Intergenic
1092857569 12:12689031-12689053 CATCTGCTCAGCTTCTGGGTAGG + Intronic
1096972327 12:55677663-55677685 AATCTGTGTATCTGCAGGGTGGG + Intergenic
1098201872 12:68064482-68064504 AATCTGTGCAGCTCTGTGGTTGG + Intergenic
1098656529 12:73037891-73037913 AATCTGAGCAATCCCAGGGTTGG + Intergenic
1098689193 12:73465452-73465474 AATCTGAGTGGCTCCACGGTTGG + Intergenic
1098694643 12:73537534-73537556 AATCTGTGGGGCTCCATGGTTGG - Intergenic
1099425439 12:82518058-82518080 AACCTGCGGAGCCCCAGAGTGGG + Intergenic
1099684365 12:85866265-85866287 AATCTGCGCAGCTCCAGAGTTGG + Intergenic
1101066481 12:101027277-101027299 AATCTGTGCAGCTCTGGGGTTGG - Intronic
1101138791 12:101773405-101773427 ACTTTGCGAAGGTCCAGGGTCGG + Intronic
1102368144 12:112357402-112357424 CATCTGCCCAGCTACTGGGTGGG + Intronic
1104763527 12:131312433-131312455 AATATGCCCAGCACCACGGTGGG + Intergenic
1104815975 12:131645644-131645666 AATATGCCCAGCACCACGGTGGG - Intergenic
1106015232 13:25863134-25863156 GATGTGGGCAACTCCAGGGTGGG - Intronic
1107927507 13:45277300-45277322 CATCTGCTCAGCTTCTGGGTAGG + Intronic
1108144616 13:47463650-47463672 AATCTGCACGGCTCCAGAGTTGG - Intergenic
1109072582 13:57787707-57787729 AATCTGCACAGCTCCGTGCTTGG + Intergenic
1110416017 13:75253606-75253628 AATCTGATCAGTTCAAGGGTGGG - Intergenic
1110790551 13:79582255-79582277 AATCTGTGCAGCTCCAGGGTTGG + Intergenic
1111200284 13:84927551-84927573 AATCTGTACAGCTCTGGGGTTGG - Intergenic
1111583895 13:90260420-90260442 CATCTGCTCAGCTCCTGGGGAGG + Intergenic
1114540252 14:23450168-23450190 TATCTGCTCAGCTTCAGGGAAGG - Intergenic
1115928892 14:38468058-38468080 AATCTGTGCAGATCTGGGGTTGG + Intergenic
1116685744 14:48036119-48036141 AATCTGTGCAGCTCCATGGCTGG + Intergenic
1118396064 14:65337774-65337796 AAGTTGTGCAGTTCCAGGGTTGG - Intergenic
1118523756 14:66617301-66617323 AATCTGCAGAGCTCTGGGGTTGG + Intronic
1120369048 14:83608098-83608120 AATCTGCACAGCTCTGGGCTTGG + Intergenic
1120799077 14:88669220-88669242 AATCTGTGCAGCTCTATGCTTGG - Intronic
1121905747 14:97741345-97741367 AATCTGTGCGGCTCTAGAGTTGG + Intergenic
1123475773 15:20591991-20592013 GACCTGGGCAGCTCCAGTGTGGG - Intergenic
1123642237 15:22408372-22408394 GACCTGGGCAGCTCCAGTGTGGG + Intergenic
1124086034 15:26551509-26551531 AATCTCCGCAGCTCAGGGGCTGG + Intronic
1125407929 15:39372314-39372336 CATCTGCTCAGCTCCTGGGGAGG + Intergenic
1126284641 15:46996887-46996909 AATCTGCCCTGCTCCAGGGTTGG + Intergenic
1126697072 15:51335391-51335413 AATCTGCTTATCTCTAGGGTTGG - Intronic
1127562195 15:60150518-60150540 GATCTGTTCAGCTCCTGGGTTGG + Intergenic
1129517048 15:76163202-76163224 AGCCTGCAGAGCTCCAGGGTGGG - Intronic
1130937718 15:88484386-88484408 AGTGTGCTCAGCTCCAGGGAGGG + Intergenic
1131942807 15:97585534-97585556 AATCTGCGCGGCTCCAGGGTTGG + Intergenic
1132464604 16:71916-71938 ACACTTCGAAGCTCCAGGGTGGG - Intronic
1135822151 16:25693418-25693440 AATCTGCCCAGCTCCAAGCCTGG + Intronic
1135849271 16:25948300-25948322 AATCAGAGCAGCTCCAGTTTGGG + Intronic
1136645204 16:31608251-31608273 AATCTGCGTGGCCCCAGGGTTGG - Intergenic
1136660038 16:31749537-31749559 AATCTGTGCAGCCACAGGGTTGG + Intronic
1138029618 16:53550059-53550081 AGTCTGCGCAGCTCAAAGGCCGG + Intergenic
1138386516 16:56639032-56639054 ACTCTGCGCAGTTCCTGGGGTGG + Intronic
1139949465 16:70662110-70662132 GAGCTGGGCAGCTCCTGGGTAGG - Exonic
1140512997 16:75521611-75521633 ACTGTGCCCAGCTCCAGGGCTGG - Intergenic
1141131655 16:81441617-81441639 AATTTGGGGAGCTCCAGGGATGG + Intergenic
1141158128 16:81610939-81610961 GATCTTCCCTGCTCCAGGGTGGG + Intronic
1141308902 16:82894242-82894264 ACTCTGCCCAGCTCCAGGGCAGG + Intronic
1142911519 17:3097591-3097613 AATCTGCACAGCTCTGGGGTTGG - Intergenic
1147861120 17:43524127-43524149 AATTTGTGCAGCTCCAGGATGGG + Exonic
1148239023 17:45987992-45988014 ACTCTGGGCAACTCCAGGGCAGG - Intronic
1149242216 17:54663577-54663599 AATCTGCACGGCTCCAGGATTGG + Intergenic
1149378001 17:56064810-56064832 ACTCTGTGCGGCTCCAGGGTTGG + Intergenic
1150196570 17:63305163-63305185 AATCTGTGCGGCTCCATGGTTGG + Intronic
1150475382 17:65470935-65470957 ACTCTGGGCAGTTCCAGGCTTGG - Intergenic
1155762818 18:29588540-29588562 AATTTGCGCAGCTCTGTGGTTGG - Intergenic
1155847745 18:30730994-30731016 AATCTATGCAGCTCTGGGGTTGG - Intergenic
1156494826 18:37518774-37518796 CAGCTGAGCAGCTCCAGGGATGG + Intronic
1156778425 18:40821703-40821725 AATGTGCGCAGCTCCGAGGTTGG - Intergenic
1157407576 18:47435994-47436016 AAGTTGAGCTGCTCCAGGGTCGG + Intergenic
1162453814 19:10770340-10770362 CATCTTCGCATCTCCGGGGTGGG + Intronic
1163397321 19:17071333-17071355 AATCTGGGCAGCCCCAGGGTAGG + Intronic
1163603910 19:18264057-18264079 AATGTGCCAGGCTCCAGGGTCGG + Intronic
1164134860 19:22405637-22405659 AATCTGCACAGCTCTGGGGTTGG - Intronic
1164163923 19:22650996-22651018 AATCTGCACAGCTCTGGGGTTGG + Intronic
1164557995 19:29268374-29268396 ACTGTGGGCAGCTCCAGGGAGGG + Intergenic
1167974829 19:53216787-53216809 CATCTGCTCAGCTCCTGAGTAGG - Intergenic
927033624 2:19149701-19149723 CATCTGCTCAGCTCCTGGGGAGG + Intergenic
927102099 2:19795785-19795807 AAGCTGCCCAGCACCTGGGTGGG + Intergenic
927428710 2:23008602-23008624 ACTCTTGGCAGCTCCAGGGATGG + Intergenic
929833780 2:45375255-45375277 CATCTGCTCAGCTTCTGGGTGGG + Intergenic
930581544 2:53217533-53217555 AATCTGCATAGCTCCACGATTGG + Intergenic
931688320 2:64813801-64813823 AATCTGCGGCTCTCCAGGGCTGG + Intergenic
932013414 2:68000517-68000539 AATCTGTGCAGCTCTGGGGTTGG - Intergenic
933129433 2:78654879-78654901 AATCTGCATAGCTCCAGGGTTGG - Intergenic
933237644 2:79882789-79882811 AATCTGCGTAGCTCTGGGGTTGG + Intronic
933602599 2:84348129-84348151 AATCTGCATGGTTCCAGGGTTGG + Intergenic
933939594 2:87234251-87234273 AATTTGGGCAGCTCCTGGGTAGG - Intergenic
935065195 2:99641279-99641301 GGTCTGTGCAGCTCCAGAGTTGG - Intronic
936353542 2:111731522-111731544 AATTTGGGCAGCTACTGGGTAGG + Intergenic
936849144 2:116874292-116874314 AATCTGCACAGCTCCTGGGTTGG + Intergenic
938192951 2:129299879-129299901 ACTCTGCGCAGCTGCGGGGGTGG + Intergenic
939192357 2:138931590-138931612 ACTCTGCACGGTTCCAGGGTTGG - Intergenic
940592515 2:155748137-155748159 AATCTGTGCAGCTCTGTGGTTGG - Intergenic
942376153 2:175339880-175339902 AATCTGTGCAGCTCCAGGGGTGG + Intergenic
943250800 2:185518998-185519020 AATCTGTACAGTTCCATGGTTGG + Intergenic
944497576 2:200324067-200324089 AGTCAGTGCAGCCCCAGGGTTGG - Intronic
944538847 2:200737863-200737885 AATCTGCAGAGATCCAGGCTGGG + Intergenic
945333154 2:208562325-208562347 AATCTCCACAGCTCAAGGGCAGG - Intronic
946196579 2:218035793-218035815 CATCTGCTCAGCTCCAGCCTTGG + Intronic
946546397 2:220749166-220749188 AATCTGCACAGCTCCAGGGTTGG - Intergenic
946936546 2:224727182-224727204 CATCTGCTCAGCTCCTGGGGAGG - Intergenic
947594207 2:231400551-231400573 AAGCTGCTGACCTCCAGGGTGGG + Exonic
948738984 2:240030693-240030715 GAGCCGGGCAGCTCCAGGGTGGG + Intergenic
1169695827 20:8385603-8385625 AATCTGCACAGCTCTGGGGTTGG + Intronic
1170496551 20:16930702-16930724 AATCTGCATGGCTCCAGGGTTGG - Intergenic
1173542935 20:43868239-43868261 AATCTGCACATGTCAAGGGTGGG + Intergenic
1173874908 20:46364271-46364293 AACCCGCGCAGATCCCGGGTGGG + Intronic
1173929533 20:46807175-46807197 AGTCTGGGCAACTCCTGGGTGGG - Intergenic
1183275566 22:36895001-36895023 AATCTGCTCAGCTTCTGGGAAGG - Intergenic
1183639204 22:39083034-39083056 AATCTTCCCAGTTCCAGGCTGGG + Intronic
950173175 3:10853202-10853224 AGTCTGGGCAGCTCCAGGCAGGG + Intronic
951137187 3:19117995-19118017 AATCTGCATGGCTCCATGGTTGG - Intergenic
951951380 3:28202764-28202786 AATCTGCATGGCTCCAGAGTTGG - Intergenic
952881561 3:37989154-37989176 AATCAGGGCAACTCCAGGTTTGG + Intronic
952974830 3:38684829-38684851 AATCGGCCCAGCTCCAGTGGAGG - Intergenic
954783140 3:53074867-53074889 AATCTGAGCTGCTCTGGGGTGGG + Intronic
956489026 3:69752051-69752073 CATCTGCTCAGCTTCAGGGGAGG - Intronic
957268919 3:78003514-78003536 AATCTGTGAGGCTCCAGGATTGG + Intergenic
957434185 3:80152350-80152372 AATCTGCATGGCTCTAGGGTTGG + Intergenic
957584396 3:82114958-82114980 AATCTGCACAGCTCTGGGGTTGG + Intergenic
958481981 3:94654432-94654454 AATCTGTGCAGCTCTGGGGTTGG + Intergenic
959046884 3:101484653-101484675 AATTGGCTCAGCTCCAGGTTAGG - Intronic
960233384 3:115254689-115254711 AATCTGCACGGCTCTGGGGTTGG - Intergenic
962207657 3:133448104-133448126 AACCTGCTAAGCACCAGGGTGGG - Intronic
963180473 3:142350164-142350186 AATATATACAGCTCCAGGGTTGG - Intronic
963400519 3:144791387-144791409 AATCTGCACAGCTCCGGGGTTGG + Intergenic
964831155 3:160885766-160885788 AATCTGCGCAGCTCCAGGGTTGG - Intronic
965838989 3:172881665-172881687 AATATGGGGTGCTCCAGGGTGGG + Intergenic
966358572 3:179109095-179109117 CATCTGCTCAGCTTCAGGGGAGG + Intergenic
966539686 3:181075421-181075443 AATCTGTGCAGCTTGGGGGTTGG + Intergenic
968673559 4:1864943-1864965 CATCTGAGAGGCTCCAGGGTGGG - Intergenic
968810274 4:2796631-2796653 AATCAGCTCAGCTACAGGGATGG - Intronic
968957642 4:3727297-3727319 AAGCTGGGGCGCTCCAGGGTGGG - Intergenic
969704289 4:8783622-8783644 AATCTGGACAGCCACAGGGTTGG - Intergenic
970204490 4:13642604-13642626 AATCTGAGCAGGTGGAGGGTTGG - Intergenic
970655968 4:18230182-18230204 AATCTGCAAAGCTACAGGGGTGG + Intergenic
972249725 4:37287208-37287230 AATCTGAGCAGCTCCAGGGTTGG - Intronic
973204395 4:47543744-47543766 AATCTCCTCAGCTGCAGAGTGGG + Intronic
973716063 4:53677416-53677438 CATCTGCTCAGCTCCTGGGGAGG - Intronic
976769310 4:88634272-88634294 AATCTGCACGGCTCCATGGTTGG - Intronic
981131242 4:141160812-141160834 CATCTGCTCAGCTCCTGGGGAGG - Intronic
981186986 4:141815739-141815761 AACCTGTGTGGCTCCAGGGTTGG - Intergenic
984092049 4:175387143-175387165 AATCTGCGTGGCTCTGGGGTTGG - Intergenic
986136210 5:4980955-4980977 GCTCTGCTCTGCTCCAGGGTGGG - Intergenic
986140598 5:5026295-5026317 AATCTGTGCAGCTCTGGGGTTGG - Intergenic
986192687 5:5511570-5511592 CATCTGCGGAGCTGCAGAGTGGG + Intergenic
986988785 5:13527760-13527782 CATCTGCGCAGCTTCTGGGGAGG - Intergenic
990016002 5:51063634-51063656 AATCTGCACAGCTCCATGGTTGG - Intergenic
990620168 5:57550497-57550519 AATCTGTGTGGCTCCATGGTTGG + Intergenic
990646122 5:57846318-57846340 AATCTGCCCAGCTCAATGCTTGG - Intergenic
993388761 5:87291790-87291812 CATCTGCTCAGCTTCTGGGTAGG - Intronic
993587378 5:89747292-89747314 AATCTGTGCAGCTCTGGGGTTGG + Intergenic
993589536 5:89777806-89777828 AATCTGCGCAGCTCTGTGGTTGG - Intergenic
995594272 5:113731293-113731315 AATCTGCACGGCTCCAGGGTTGG + Intergenic
995696909 5:114889148-114889170 AATCTGCACATGTCAAGGGTGGG - Intergenic
996675644 5:126171983-126172005 AATCTGCATGGCTCCATGGTTGG - Intergenic
996965967 5:129307099-129307121 AATCTGCGTGGCTCCAGGATTGG + Intergenic
997955865 5:138278173-138278195 CATCTGCTCAGCTCCTGGGTAGG - Intergenic
998788760 5:145743733-145743755 AATCTGCATGGCTCCAGGGTTGG - Intronic
999596851 5:153214620-153214642 AATCTGCACAGCTCTGTGGTTGG - Intergenic
1003248693 6:4405695-4405717 AATGTGCGCGGCTCCAAGTTTGG - Intergenic
1004044707 6:12012505-12012527 CAGCAGCGCAGCTCCAGGGCCGG + Exonic
1004760038 6:18656448-18656470 AATCTGTGTGGCTCCAGGGTTGG - Intergenic
1005121100 6:22390035-22390057 AATCTGCGCAGCTCCAGGGTTGG + Intergenic
1007115503 6:39340309-39340331 AAGCTCCCCAGCTGCAGGGTGGG + Intronic
1008834450 6:55808558-55808580 AACCTGCACAGGTCCATGGTTGG + Intronic
1008920762 6:56843022-56843044 AAGCTCCGCAGCCCCAGGGCAGG + Intronic
1009316769 6:62229589-62229611 AATCTGTGCAGCTCCATGGTTGG + Intronic
1009916842 6:70006243-70006265 AATCTGCGCAGCTCTGGGGTTGG + Intronic
1010283004 6:74041697-74041719 AATCTGTGCAGCTCCATGGTTGG + Intergenic
1011556813 6:88578302-88578324 AATCTTCGCAACTTCAGGTTAGG - Intergenic
1011649209 6:89490529-89490551 CATCTGAGCATCTCCAGGGCAGG - Intronic
1011944069 6:92879633-92879655 AATCTGCGCAGCTCTGTGGTTGG - Intergenic
1012741215 6:103018589-103018611 AATCTGCATGGCTCCATGGTTGG + Intergenic
1014484809 6:121985302-121985324 AATCTGCACCACTCCATGGTTGG + Intergenic
1018395913 6:163377924-163377946 CATCTGCGCTGCTCCAGGGAAGG - Intergenic
1018608394 6:165623040-165623062 CATCTGCTCAGCTTCTGGGTGGG - Intronic
1021199566 7:17712841-17712863 AATCTGCACATCTGCAGGGTGGG - Intergenic
1021244175 7:18241432-18241454 AATCTGAGCAGCCACAGGGCAGG - Intronic
1024788982 7:52940913-52940935 TTTCTGCCCAGCTCCATGGTTGG + Intergenic
1025271102 7:57517935-57517957 AATCCCCGCAGGTCAAGGGTGGG + Intergenic
1026304581 7:69129557-69129579 AATCTGCTCAGCTTCTGGGGAGG + Intergenic
1028048853 7:86158194-86158216 AATCTGGGCAGCTCCAGGGTTGG - Intergenic
1028210918 7:88073454-88073476 CATCAGGGCAGTTCCAGGGTTGG - Intronic
1028459120 7:91071580-91071602 AATCTGAGCAGCTCCATGGTTGG - Intronic
1028779538 7:94719959-94719981 AATCTGCACAGCTCCGTGGTTGG + Intergenic
1029633100 7:101765539-101765561 CATCTGCTCAGCTTCTGGGTAGG - Intergenic
1029895473 7:103978896-103978918 AATCTGTGAGCCTCCAGGGTGGG - Intronic
1030307185 7:108030818-108030840 AATCTGCCCAACACCAGGCTGGG - Exonic
1030759300 7:113331511-113331533 AATCTGTGCAGCTCCAGTGTTGG - Intergenic
1034311713 7:150094626-150094648 AATATGAGCAGCTGCAGGGCTGG - Intergenic
1034424616 7:151007917-151007939 AATCTGCTGAGCTCCAGCCTGGG - Intronic
1034795140 7:154006028-154006050 AATATGAGCAGCTGCAGGGCTGG + Intronic
1035491638 7:159284586-159284608 AGTCTGCGTGGCTCCTGGGTTGG - Intergenic
1038073643 8:24046133-24046155 AATCTGCACAGCTCCGTGGCTGG - Intergenic
1039658187 8:39433312-39433334 AATCTGCATGGCTCCATGGTTGG - Intergenic
1040841774 8:51792462-51792484 AATCTGCACAGCTCTATGCTTGG - Intronic
1040959703 8:53018972-53018994 AATCTGCAGGGCTCCAGGGTTGG - Intergenic
1041223332 8:55673574-55673596 AATCTGCTCAGCTTCTGGGGAGG + Intergenic
1041315963 8:56562815-56562837 CATCTGCTCAGCTCCTGGGGAGG - Intergenic
1042304080 8:67313576-67313598 AGTCTACCCAGCTCCAGGCTTGG + Intronic
1044047789 8:87459558-87459580 AGTCTGCATAGCTACAGGGTGGG + Intronic
1047976040 8:130131824-130131846 AAAATGCGCAACTTCAGGGTGGG + Intronic
1051374038 9:16386333-16386355 AATCTTTGCGGCACCAGGGTGGG + Intergenic
1052716908 9:32128585-32128607 AATCTGCGCAGCTCCGTGGTTGG - Intergenic
1053472163 9:38354644-38354666 CATCTGCTCAGCTTCAGGGAAGG + Intergenic
1053570434 9:39299418-39299440 ATTCTGTGCAGTTCCAGGGATGG - Intergenic
1054092055 9:60858427-60858449 ATTCTGTGCAGTTCCAGGGATGG - Intergenic
1054113468 9:61134017-61134039 ATTCTGTGCAGTTCCAGGGATGG - Intergenic
1054126715 9:61319593-61319615 ATTCTGTGCAGTTCCAGGGATGG + Intergenic
1054594230 9:67048155-67048177 ATTCTGTGCAGTTCCAGGGATGG + Intergenic
1056581501 9:87890243-87890265 GACCTGGGCAGCTCCAGTGTGGG + Intergenic
1057752161 9:97802037-97802059 AAGCTGCTCAGCTGCAGAGTTGG - Intergenic
1058590983 9:106565270-106565292 AATCTGCGTGGCTCCAGGGTTGG - Intergenic
1059262746 9:112994065-112994087 AATCTGCACAGCTCTGTGGTAGG + Intergenic
1060724600 9:125998600-125998622 AATCTGTGTAGCTTCAGGATGGG + Intergenic
1188092101 X:25976820-25976842 AATCTGCGTGACTCCCGGGTTGG - Intergenic
1188884280 X:35531119-35531141 AATCTGCATGGCTCCTGGGTCGG - Intergenic
1192026289 X:67456498-67456520 AATCTACACAACTTCAGGGTTGG - Intergenic
1192632219 X:72786350-72786372 AATCTGTGAAGGTCCAGGGCTGG + Intronic
1192649490 X:72934451-72934473 AATCTGTGAAGGTCCAGGGCTGG - Intronic
1193062309 X:77219990-77220012 AATCTCCATGGCTCCAGGGTTGG - Intergenic
1194286732 X:92020112-92020134 AATCTATGCAGCTCCGTGGTTGG - Intronic
1194851907 X:98880881-98880903 AATCTGCACAGCTCTGGGGTTGG - Intergenic
1195147122 X:102029088-102029110 AATCTGCGTGGCTCCATGGTTGG - Intergenic
1195153372 X:102097190-102097212 AATCTGCTCAGCTCTGTGGTTGG - Intergenic
1195979413 X:110561497-110561519 AATCTGCGCAGCTCCATGGTTGG + Intergenic
1195983068 X:110600817-110600839 AATCTGCACAGCTCCAGGATTGG - Intergenic
1196168934 X:112565837-112565859 AATCTTGGCAGCTCCAGCTTCGG - Intergenic
1197030164 X:121803265-121803287 AATCTGCATGGCTCCGGGGTTGG + Intergenic
1198054100 X:132976818-132976840 TATCTGCTCAGCTTCTGGGTTGG + Intergenic
1198100229 X:133415969-133415991 TATCCGCGCAGCTCCCGGGCTGG + Intergenic
1200604277 Y:5244672-5244694 AATCTATGCAGCTCCGTGGTTGG - Intronic