ID: 964832269

View in Genome Browser
Species Human (GRCh38)
Location 3:160897386-160897408
Sequence TCCTGATGTCTCTAACTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964832267_964832269 -6 Left 964832267 3:160897369-160897391 CCAGATGATGACATTGCTCCTGA 0: 1
1: 0
2: 2
3: 24
4: 193
Right 964832269 3:160897386-160897408 TCCTGATGTCTCTAACTAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 69
964832266_964832269 24 Left 964832266 3:160897339-160897361 CCAACTACTGACTCTTATAAAGA 0: 1
1: 0
2: 0
3: 17
4: 173
Right 964832269 3:160897386-160897408 TCCTGATGTCTCTAACTAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 69
964832265_964832269 29 Left 964832265 3:160897334-160897356 CCTGGCCAACTACTGACTCTTAT 0: 1
1: 0
2: 0
3: 27
4: 236
Right 964832269 3:160897386-160897408 TCCTGATGTCTCTAACTAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964832269 Original CRISPR TCCTGATGTCTCTAACTAGG TGG Intronic
902569816 1:17340146-17340168 TCCTGATGTCTCTGATTAGCAGG - Intronic
907727539 1:57033829-57033851 TGCTGATGTCTGTAACTGCGGGG - Intronic
910855728 1:91693423-91693445 TCCTGAAGTCTCTGGCTTGGGGG + Intronic
911474173 1:98355991-98356013 TCCTGATGTCTCTTTTTATGTGG - Intergenic
914801858 1:150968021-150968043 TCCTGATGTGTCTTGCTGGGAGG - Intronic
915612814 1:157008370-157008392 TCCTGATGTCTCTTCTTAGAAGG - Intronic
915738958 1:158103526-158103548 TCCTGATGTCTCTAAGGAAGAGG - Intergenic
916016117 1:160751112-160751134 TCCTGATCTCTCCATCAAGGTGG - Intronic
916688494 1:167169503-167169525 TCCTGAGGTCTCTAACGTAGAGG - Intergenic
920019128 1:202940547-202940569 TACTGATTTCTCTAACAAGATGG + Intergenic
920608000 1:207408896-207408918 TCCTGAAGTTTCCAACTATGAGG + Intergenic
922203356 1:223425753-223425775 TGATGATGTCACTAACTGGGTGG - Intergenic
923302014 1:232650162-232650184 TACTCATGTCACTAACTAGCTGG - Intergenic
924545065 1:245018961-245018983 CCCTGATGTCTCTAAAGAGTAGG - Intronic
1066670207 10:37829178-37829200 TAATGATGTCTCTTACAAGGTGG + Exonic
1067402584 10:45991078-45991100 TCCTGATTTCTCTATCCTGGAGG - Intronic
1083199601 11:61112282-61112304 TCCTGATTTCTCTCGCTAGCTGG + Intronic
1083288355 11:61675506-61675528 TCCTGATGCATCTGACGAGGTGG - Intergenic
1086781530 11:90911982-90912004 TCCTGATGACTCAAATTATGAGG + Intergenic
1090094099 11:123726692-123726714 TCCTCAGGTGTCTAACAAGGTGG + Exonic
1100028429 12:90157079-90157101 TCCTGATGTCTTTGACTAATTGG + Intergenic
1101077062 12:101141392-101141414 TCCTGATGTTTCCATCCAGGTGG - Intergenic
1108572070 13:51761651-51761673 TCATTACTTCTCTAACTAGGGGG + Exonic
1109923660 13:69104978-69105000 TTTTGATTCCTCTAACTAGGAGG - Intergenic
1112995266 13:105567122-105567144 TCATGCTTTCTCTAACTTGGGGG - Intergenic
1120945400 14:89990344-89990366 TCCTGATTACACTAACTAGCGGG - Intronic
1129519865 15:76178767-76178789 TCCAGATGTCGCTACCTAGAGGG - Intronic
1131968687 15:97871427-97871449 TCCTGAGGCCTCTAGCCAGGAGG + Intergenic
1134223481 16:12373919-12373941 TCCTGATGTCTCAATTTAAGTGG + Intronic
1149474592 17:56949386-56949408 TCCTGATGTCTCTGACTACAAGG - Exonic
1155131133 18:22935599-22935621 TCCTGAGGTCTCTGACAAAGGGG - Intronic
1155405121 18:25479362-25479384 TACTGATGTGTCTAACAAGTCGG + Intergenic
926581857 2:14639302-14639324 TCCTGGTTTCTCTAACTAAAAGG + Exonic
929136065 2:38624881-38624903 TCCTGAAGTCTCTAAGTACACGG + Intergenic
929844312 2:45506148-45506170 TTCTGATGTATCTAACCAGATGG - Intronic
937147916 2:119663292-119663314 TCCTGCTCTCTCTCACTAGATGG + Intergenic
942508489 2:176669894-176669916 TCCTGATGTCTCCAACTTTCTGG - Intergenic
944668346 2:201974896-201974918 TCCTTATCTCTCCAACTAGGCGG + Intergenic
946887553 2:224238162-224238184 TCCTGAAATCTCCATCTAGGCGG + Intergenic
947617415 2:231567326-231567348 TCCTGATGTCTCTTCTTATGAGG - Intergenic
948646618 2:239409097-239409119 TCCTGATACCTCTAACTCAGGGG + Intergenic
1173461341 20:43245637-43245659 CACTAATGTCTCTAACTTGGGGG - Intergenic
1177243815 21:18496312-18496334 CCCTTATTTCTCTAAATAGGGGG - Intergenic
1178499269 21:33112283-33112305 TCCTGATGTGTGTCACTTGGAGG + Intergenic
950966958 3:17153168-17153190 TCCTGATAACTCTGACTAGCAGG - Intergenic
951261481 3:20514695-20514717 TCCTTCTGACTCTAAATAGGTGG - Intergenic
964832269 3:160897386-160897408 TCCTGATGTCTCTAACTAGGTGG + Intronic
967474607 3:189902174-189902196 ACCTGATGTTCCTAGCTAGGTGG + Intergenic
974779401 4:66533074-66533096 TAATACTGTCTCTAACTAGGTGG - Intergenic
977691798 4:99919649-99919671 TCCTGAGGTCCCTACCTAGTTGG + Intronic
987262302 5:16215864-16215886 TCCTGTGGTCTCTATCTTGGAGG + Intergenic
987543204 5:19281177-19281199 TTCTGATGTCTCTTACTATAAGG + Intergenic
989566387 5:42905242-42905264 TCCTGTTGCCTCTATCTAGAAGG - Intergenic
991528465 5:67590389-67590411 TCAAGATGTCTCTAATTGGGAGG + Intergenic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
997978979 5:138457479-138457501 TCTTTCTGTCTCTACCTAGGAGG + Intergenic
1001746158 5:174093957-174093979 TCCTGAGGTTTCTACCTGGGTGG + Intronic
1003905459 6:10695078-10695100 TCCGACTGTCTCTAACTACGCGG - Intronic
1008532788 6:52479876-52479898 TTCTGATTTCTCTCACCAGGTGG + Intronic
1009334005 6:62462442-62462464 TCCTCATCTCTCTTACTTGGAGG - Intergenic
1012502453 6:99904142-99904164 TTCTCATGTCTCTAATTAAGAGG + Intergenic
1015109642 6:129577249-129577271 TCTTGATGTCTCTAATGAAGGGG - Exonic
1017714250 6:157197155-157197177 TCATCATGTCTCTTACTAGGAGG - Intronic
1020668808 7:11080588-11080610 CCCTGATGTCTCAAAATAGAAGG + Intronic
1021377255 7:19923358-19923380 ACTTGAAGTCTCTACCTAGGAGG + Intergenic
1037116335 8:15233244-15233266 TTCTGATGAATCTAAGTAGGTGG - Intronic
1039200726 8:35090782-35090804 TTCTAATGCCTCTAACAAGGTGG - Intergenic
1042716867 8:71783724-71783746 TACTGATTTCTCTAACGTGGAGG - Intergenic
1048430654 8:134367567-134367589 TTCTGATCTCTCTAACTAGCTGG - Intergenic
1055847528 9:80584854-80584876 TACTGATGTCTTTAATTATGTGG - Intergenic
1186680018 X:11862873-11862895 TCTTGATGTCTATAACTTTGTGG + Intergenic
1188135840 X:26493843-26493865 TCCTGTTATTTCTAACTAGCAGG - Intergenic
1189667440 X:43371959-43371981 TACTGATGTCTCTAACTCTATGG - Intergenic
1192816754 X:74601690-74601712 TCCTGATGTCCCTATCAAAGAGG - Intronic
1196657491 X:118233964-118233986 TCCTGAAGTTTCCAACTATGTGG - Intergenic
1197980283 X:132211012-132211034 TCCCAATATCTCTAACTCGGTGG + Intronic