ID: 964832738

View in Genome Browser
Species Human (GRCh38)
Location 3:160903604-160903626
Sequence GTAGCTATTATTTTTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 654
Summary {0: 1, 1: 0, 2: 4, 3: 73, 4: 576}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964832736_964832738 -1 Left 964832736 3:160903582-160903604 CCATCAAAATATTTAATAAATGG 0: 1
1: 0
2: 3
3: 79
4: 738
Right 964832738 3:160903604-160903626 GTAGCTATTATTTTTAAAGATGG 0: 1
1: 0
2: 4
3: 73
4: 576
964832734_964832738 26 Left 964832734 3:160903555-160903577 CCTTACCAAGTTTACATATAAAA 0: 1
1: 0
2: 6
3: 119
4: 843
Right 964832738 3:160903604-160903626 GTAGCTATTATTTTTAAAGATGG 0: 1
1: 0
2: 4
3: 73
4: 576
964832735_964832738 21 Left 964832735 3:160903560-160903582 CCAAGTTTACATATAAAATATAC 0: 1
1: 0
2: 2
3: 81
4: 781
Right 964832738 3:160903604-160903626 GTAGCTATTATTTTTAAAGATGG 0: 1
1: 0
2: 4
3: 73
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964832738 Original CRISPR GTAGCTATTATTTTTAAAGA TGG Intronic
900012345 1:127336-127358 GTAGATATTAATTTTAGATATGG + Intergenic
900042405 1:483320-483342 GTAGATATTAATTTTAGATATGG + Intergenic
900063846 1:718313-718335 GTAGATATTAATTTTAGATATGG + Intergenic
900464156 1:2816121-2816143 TTTACTATTATTTTAAAAGAAGG + Intergenic
902200303 1:14828394-14828416 ATAGCTGTAATTTTTAAACACGG - Intronic
902453102 1:16511272-16511294 TTAGCTAATTTTTTTAAAGCTGG - Intergenic
904526026 1:31134651-31134673 TTATTTATTATTTTTAGAGATGG + Intergenic
904718558 1:32488254-32488276 TTTGCTGTTATTTTAAAAGAGGG + Exonic
905456907 1:38094634-38094656 GTGAGGATTATTTTTAAAGAGGG + Intergenic
906762550 1:48389013-48389035 GTAGCTATTTTTAGTAGAGATGG + Intronic
907949780 1:59171184-59171206 GTAGCTATTATTATTAACTTGGG + Intergenic
908271399 1:62425983-62426005 TTAGAAAATATTTTTAAAGATGG + Intergenic
908285549 1:62594958-62594980 GTAACTTTTCTATTTAAAGAAGG + Intronic
908546222 1:65164828-65164850 GTAGCCATTGTTTTTAAACATGG + Intronic
909759288 1:79269177-79269199 GTAGGTATTATTTCTAGAGCTGG - Intergenic
909876278 1:80808019-80808041 ATAACAATTATCTTTAAAGAGGG - Intergenic
909990407 1:82216581-82216603 GAAGCTATAATTTTGAAGGAAGG + Intergenic
910138159 1:83997387-83997409 GCATCCATTATTTTTACAGAAGG + Intronic
911069793 1:93823704-93823726 GTTGTTATTATTTTTTGAGACGG + Intronic
911949173 1:104150701-104150723 GTAGTTATATTTTTTAATGAAGG - Intergenic
913941831 1:125116640-125116662 CTAGCTAATTTTTGTAAAGATGG - Intergenic
914005147 1:143726234-143726256 TTAGCTAATTTTTTTAAAGTTGG - Intergenic
915235834 1:154480907-154480929 GCAAGTATTTTTTTTAAAGAAGG + Exonic
915696051 1:157743128-157743150 CTAGCTATTATTTTTAACAATGG + Intergenic
916784038 1:168070518-168070540 GGAGCTGTGATTTTTAATGAAGG + Intronic
917163509 1:172084629-172084651 GTAGCTATAAATTTTAAAGTTGG + Intronic
917934487 1:179851431-179851453 GTAAATATTATTATTAAACAGGG - Intronic
917994960 1:180427301-180427323 GGAACTGTTATTTTTAAAAAAGG - Intronic
918818496 1:189223295-189223317 TTTGATATAATTTTTAAAGATGG + Intergenic
918882761 1:190146766-190146788 GTAAATAATATTTTAAAAGAGGG - Intronic
919041716 1:192396967-192396989 GTAGTTATGATTTTTAATAATGG - Intergenic
919402482 1:197137067-197137089 GTAGATATTATTTTTAGATATGG + Intronic
920906141 1:210171366-210171388 TTAGTTAACATTTTTAAAGAGGG + Intergenic
920911520 1:210222208-210222230 GTAGCTATTGTTATTAAACAGGG + Intergenic
921051777 1:211516180-211516202 TTAACAATTTTTTTTAAAGACGG + Intergenic
921066701 1:211628227-211628249 ATAGCTATTTTTTTAAAAAAAGG + Intergenic
921084989 1:211781937-211781959 ATACATATTATTTTTAAAAATGG + Intronic
921271183 1:213471596-213471618 GTAGCAATTATGTTTAGAAAAGG - Intergenic
921279878 1:213555979-213556001 GTGGCTCTGATTTTTGAAGAAGG - Intergenic
921733723 1:218602515-218602537 TTAACAATTATTTTTAAACAAGG + Intergenic
921733724 1:218602544-218602566 TTAACAATTATTTTTAAACAAGG - Intergenic
922133679 1:222804306-222804328 ATAGCTATTATTATTACAGTTGG - Intergenic
922260777 1:223943804-223943826 GTAGATATTAATTTTAGATATGG + Intergenic
922469351 1:225866397-225866419 GAAACTGTTTTTTTTAAAGATGG + Intronic
922642496 1:227247488-227247510 GTAGCTATTGTTTTTTAAGATGG - Intronic
922671479 1:227511255-227511277 TTAGCAATTTTTTTTAAAAAAGG - Intergenic
922736292 1:227981927-227981949 GTAGATATTAATTTTAGATATGG - Intergenic
924341953 1:243045990-243046012 GTAGATATTAATTTTAGATATGG + Intergenic
924441913 1:244093327-244093349 GTGCCGATTATTTCTAAAGACGG + Intergenic
924867825 1:248004949-248004971 GGAGCTAAAATTTTTAAAAATGG + Intronic
1063699728 10:8372439-8372461 GTCGCTTTTTTTTTTTAAGATGG - Intergenic
1063801238 10:9580806-9580828 TAAGCTATAATATTTAAAGAAGG + Intergenic
1063881783 10:10539164-10539186 GTAGCTATGAGATTTAGAGATGG + Intergenic
1064419270 10:15176733-15176755 GTAGTTATTATTGTTAAAAATGG - Intergenic
1064611606 10:17109035-17109057 ATATCTATTATTGTCAAAGATGG + Intronic
1065665755 10:28058109-28058131 GTGTCTATAATTTTTAACGATGG - Intronic
1066028973 10:31397905-31397927 ATAGATATTATTTTTGAAGTTGG + Intronic
1066114743 10:32229790-32229812 CTAGTTTTTGTTTTTAAAGATGG - Intergenic
1066238318 10:33508510-33508532 ATTACTATTATTTGTAAAGATGG - Intergenic
1066316794 10:34255371-34255393 TTACCTAGGATTTTTAAAGAAGG - Intronic
1066734529 10:38459549-38459571 GTAGATATTAATTTTAGATATGG - Intergenic
1066782523 10:38968196-38968218 CTAGCTAATTTTTGTAAAGATGG - Intergenic
1066954588 10:42152431-42152453 CTAGCTAATTTTTGTAAAGATGG + Intergenic
1067383768 10:45799567-45799589 GAAGCAGTTATTTTTAAAGATGG - Intergenic
1067880416 10:50039225-50039247 GAAGCAGTTCTTTTTAAAGATGG + Intergenic
1068526191 10:58133102-58133124 GTAGATATATTTTTAAAAGAGGG + Intergenic
1068616221 10:59120594-59120616 GTAGGTATAATTTTTAATGGTGG - Intergenic
1068873001 10:61965287-61965309 TTTCCTATTATCTTTAAAGAGGG - Intronic
1069142489 10:64843578-64843600 GAAGATCTTGTTTTTAAAGAAGG + Intergenic
1069404173 10:68080289-68080311 GTAGCCATGTTTTTAAAAGATGG + Intergenic
1070338668 10:75477148-75477170 CTAGCTAATTTTTTTAGAGATGG + Intronic
1070960149 10:80493226-80493248 ATGGCTATTATTTTAAAAAATGG + Intronic
1072177473 10:92942602-92942624 GTAGCATTTATTGATAAAGATGG + Intronic
1073360912 10:102897769-102897791 CTGGCTATTTTTTTTAAAAAAGG + Intronic
1073416574 10:103388248-103388270 GAAGCTACTGTTTTTAAAAAGGG + Exonic
1073687201 10:105768248-105768270 GTTGCTGTTATTTTTCAACAAGG - Intergenic
1073744989 10:106457888-106457910 GTATGTATTATTTTGAAAAATGG + Intergenic
1073771176 10:106737428-106737450 ATAAATATTTTTTTTAAAGAGGG + Intronic
1073881784 10:107990041-107990063 GTAGCTTTTTTTTTAGAAGAAGG + Intergenic
1073881931 10:107991942-107991964 GTAGCTATTATTTTGGAGGAGGG + Intergenic
1073980309 10:109146556-109146578 ACAGCTATTATTTTTTAAAAAGG + Intergenic
1074729850 10:116359427-116359449 GTAGATGTTATTTTTATAGCAGG + Intronic
1074866791 10:117548753-117548775 TTACTAATTATTTTTAAAGATGG - Exonic
1074993200 10:118730635-118730657 TTGGTTGTTATTTTTAAAGATGG - Intronic
1074993767 10:118737198-118737220 GCAGCAATTATTTCTAAAGTAGG + Intronic
1076968677 11:119540-119562 GTAGATATTAATTTTAGATATGG + Intergenic
1077560031 11:3254345-3254367 ATAGCTGTCATTTATAAAGAAGG - Intergenic
1077565924 11:3300148-3300170 ATAGCTGTCATTTATAAAGAAGG - Intergenic
1078409964 11:11106449-11106471 GGGGCTATTTTTTTTTAAGATGG - Intergenic
1078516925 11:12030558-12030580 GTAGTTCTTATTTTTGTAGAAGG + Intergenic
1079502981 11:21123102-21123124 GTTACTCTTATTTTTAAAAAGGG - Intronic
1079781615 11:24613723-24613745 GAAGTTATTATTTTTTAAAAAGG + Intronic
1080191486 11:29554436-29554458 ATAGTTGTTATTTTAAAAGAGGG + Intergenic
1081224908 11:40508882-40508904 GTAGCTATTAAATTAAAATAAGG + Intronic
1081518656 11:43860159-43860181 ATAATTTTTATTTTTAAAGATGG + Intergenic
1082107887 11:48240687-48240709 ATAGATATAATTTTAAAAGAAGG + Intergenic
1082654148 11:55832519-55832541 ATAGCATTTATTTTAAAAGACGG + Intergenic
1082968291 11:58991287-58991309 GTAGCTTTCATTTTTATAGATGG + Intronic
1083038501 11:59663641-59663663 TAAGCTTTTATTTTTAGAGAAGG + Intronic
1083958231 11:65998779-65998801 GTAGATATTATTTTCCCAGAAGG - Intronic
1085238912 11:75035845-75035867 ATAGCTGTTATTTTTAAATGGGG - Intergenic
1085668431 11:78438135-78438157 GTAGCCATTATTATTAATGGTGG - Intronic
1085897250 11:80654732-80654754 ATAGCTATTATTTATAAGGGAGG - Intergenic
1086046282 11:82535646-82535668 GTAGTTTGTATTTTTCAAGATGG + Intergenic
1086104982 11:83137877-83137899 GTTATTATTATTTTTTAAGATGG - Intergenic
1086118097 11:83275946-83275968 TTAGCTATTATTATTACCGATGG + Intronic
1086591802 11:88523820-88523842 GTAGTTATTATTTTGAAAATAGG + Intronic
1088000358 11:104872851-104872873 TCAGTTATTATTTTTAAAGTAGG - Intergenic
1088857370 11:113768330-113768352 GTTGTTGTTATTTTGAAAGATGG - Intronic
1089301663 11:117502611-117502633 GAAGCTATGATTCTTAAAGGTGG + Intronic
1092385986 12:8036057-8036079 GTAGCTGTTGTTTTTAAATGGGG - Intronic
1092694308 12:11151995-11152017 ATAGGTATTATTTTTACAGTCGG + Intronic
1093484599 12:19639667-19639689 GTAACTATTATTTGTGAAGAAGG - Intronic
1093674014 12:21913239-21913261 GTAGCTACTATTTTCGTAGAAGG - Intronic
1093940553 12:25049684-25049706 ATGGCTATTATTTTAAAAGACGG + Intronic
1094540360 12:31358225-31358247 ATAGAAATTATTTTTAAAGTCGG + Intergenic
1095274152 12:40259846-40259868 GGAGCTTTTATTTTTAAGGAGGG + Intronic
1095394148 12:41743339-41743361 TTCAATATTATTTTTAAAGATGG + Intergenic
1095750986 12:45711203-45711225 GTATCTATTTGTTTTAAAGTTGG - Intergenic
1096026654 12:48370477-48370499 GTGGCTGTTTTTTTAAAAGATGG + Intergenic
1096562409 12:52446093-52446115 GTATCTATTAGTTTGAATGATGG + Intergenic
1097539577 12:60922517-60922539 GTAGTTAATGTTTTTTAAGATGG + Intergenic
1097948106 12:65395489-65395511 CTTGTTATTATTTTTAAAGCTGG - Intronic
1098576478 12:72048496-72048518 ATAGCTAATATTGTTAAAGTTGG - Intronic
1098723904 12:73938434-73938456 GATGTTATTATTGTTAAAGAGGG - Intergenic
1099139973 12:78960763-78960785 CTAGCTAAAAGTTTTAAAGAAGG + Intronic
1099399802 12:82189214-82189236 GCTACTATTATTTTTAAATAGGG - Intergenic
1099622969 12:85027266-85027288 GTAGACACTATTATTAAAGAGGG + Intronic
1099835021 12:87898769-87898791 GTAAATAATATTTTTAAAAAAGG - Intergenic
1100511377 12:95277827-95277849 ATAGCTGTTATTCTTTAAGAAGG + Intronic
1100586573 12:95986200-95986222 TTATTTATTTTTTTTAAAGATGG + Intronic
1100748322 12:97669912-97669934 CTGGCTATAATTTTTAAAAAAGG - Intergenic
1101079436 12:101167794-101167816 CTAGCTATTAATTTTTGAGAAGG + Intronic
1101212051 12:102544367-102544389 GTAGGTAATATTTGTAAAGTAGG + Intergenic
1101556591 12:105815592-105815614 ATTGATATTATTTTTAAACATGG - Intergenic
1102277539 12:111594906-111594928 GTAACCATTATTATTAATGAGGG - Intronic
1102673481 12:114639766-114639788 GCAGCTATTTTTTGTAGAGATGG - Intergenic
1102790103 12:115637702-115637724 ATTGCTATAATTTTTAAAGTAGG + Intergenic
1103259002 12:119569237-119569259 TTATTTATTATTTTTTAAGAAGG - Intergenic
1103753210 12:123181724-123181746 TCAGCTATTTTTTTTTAAGACGG - Intronic
1103915797 12:124374967-124374989 GTTGCTATTGTTTCTAAAAAGGG - Intronic
1104679300 12:130738193-130738215 CTAACTTTTATTTTTAAAAAAGG - Intergenic
1104750963 12:131238269-131238291 GTGGCTATTATTTTTCAGCAGGG - Intergenic
1105539569 13:21303851-21303873 GTATACATTTTTTTTAAAGATGG - Intergenic
1105798768 13:23884380-23884402 GTATACATTTTTTTTAAAGATGG + Intronic
1105941808 13:25154280-25154302 GGAGAAATTATTTTTAAAGCTGG + Intergenic
1106244160 13:27933001-27933023 GTATTTATTATTTTTTGAGATGG - Intergenic
1106479039 13:30123242-30123264 GGAGCTGGTATTTTTAAAGTAGG - Intergenic
1107003865 13:35584799-35584821 CCAGCTATTATTTTTAAACATGG + Intronic
1107158975 13:37203448-37203470 ATATCTATTTTTTTTAAAAAAGG - Intergenic
1107396748 13:40025836-40025858 GTTGAAATTATTTTTAAAAAAGG + Intergenic
1108005308 13:45940273-45940295 GAAGCTGTTTTTTTTAAAGCTGG + Intergenic
1108892827 13:55282376-55282398 GTATCTATTATTTGTAAAGATGG - Intergenic
1108915057 13:55598362-55598384 GAAGATATTCTTTTTAATGATGG - Intergenic
1109084771 13:57955833-57955855 ATATATATTATTTTTTAAGATGG + Intergenic
1109445918 13:62440456-62440478 GAAGCAATCATTTTAAAAGATGG + Intergenic
1109447417 13:62460355-62460377 ATAGATATTAATTTTAAATAGGG - Intergenic
1109480624 13:62947041-62947063 GAAGTGATTATTTTTAAGGAAGG + Intergenic
1109498409 13:63206506-63206528 GTAGTTATTAATTTTAAAACTGG + Intergenic
1109531712 13:63658144-63658166 GAAGATATTATTTTTGAATAAGG - Intergenic
1109615194 13:64825868-64825890 GTAATTATTATTTTTTGAGATGG + Intergenic
1109726037 13:66343113-66343135 GTAACTATTATTTTTATTGATGG - Intronic
1110465805 13:75799747-75799769 GTAACTATAATTTTTTAATATGG - Intronic
1110473391 13:75885876-75885898 CTACTTATTATTTTTAAAAAAGG - Intergenic
1111121249 13:83853587-83853609 GCAGATATTGGTTTTAAAGAAGG + Intergenic
1111758155 13:92425360-92425382 TTAGCCATAATTTTTAGAGAGGG - Intronic
1111775876 13:92661127-92661149 CTAATTATTATTATTAAAGATGG - Intronic
1112063043 13:95761259-95761281 GGAGCTTTTTTTTTTAGAGAAGG + Intronic
1112773679 13:102820834-102820856 TTAGCTATTTTTGTTAAAGCAGG + Intronic
1113126244 13:106982582-106982604 GTAGCAGATATTTTTACAGAGGG + Intergenic
1114154643 14:20086974-20086996 GATGGAATTATTTTTAAAGAGGG + Intergenic
1114321667 14:21551749-21551771 GTAGGTATTTTTTGTAGAGACGG - Intergenic
1114457121 14:22862976-22862998 CTAGTTTTTATTTTTAAAGAAGG + Intergenic
1115573816 14:34692030-34692052 GCAGCTATTTTTTGTAGAGATGG + Intergenic
1115663296 14:35518878-35518900 ATATCTATTTTTTTTCAAGATGG + Intergenic
1115666940 14:35561283-35561305 TTAGCTATTCTTTTCAAAAATGG - Intronic
1115722974 14:36183162-36183184 GTATCTATTTTTTTGAAACAGGG - Intergenic
1115841146 14:37471797-37471819 GTAGGTATTAATTTGAAGGAGGG - Intronic
1116944215 14:50821132-50821154 ATAGCTATTAATTATAAATAAGG + Intronic
1117471662 14:56052103-56052125 GTATCTATTAATTATAAAGTTGG + Intergenic
1117546811 14:56799538-56799560 GTCATTATTGTTTTTAAAGAAGG + Intergenic
1117722477 14:58641087-58641109 ATAGCTTTTATTTTTAAACTTGG - Intronic
1117826540 14:59710215-59710237 GTATCTTTTTTTTGTAAAGATGG + Intronic
1118021922 14:61725822-61725844 GTAGCTTTTTTTTTTTGAGATGG + Intronic
1118535794 14:66762924-66762946 GTAGCTATTGTTTTAAAATATGG - Intronic
1119113600 14:71997871-71997893 TTGGCTATAAATTTTAAAGAAGG + Intronic
1119378901 14:74216351-74216373 GACGGTATTATTTTTAAAAAAGG - Intergenic
1120092498 14:80348912-80348934 ATATCTAATATTTTTAAATATGG + Intronic
1120115341 14:80610081-80610103 TTATATATTATTTTTAAAAATGG - Intronic
1120541154 14:85752583-85752605 GTAGATATGATTTTTAATGCTGG - Intergenic
1120789339 14:88564476-88564498 GTAGCTATTATTTTTATAGGAGG - Intronic
1120825731 14:88953340-88953362 GTGGCTATTATTTTTATATGTGG + Intergenic
1122439520 14:101720478-101720500 GTATCAATTTTTTTTAAAGAGGG + Intergenic
1123670816 15:22655161-22655183 ATTTGTATTATTTTTAAAGATGG - Intergenic
1123764810 15:23467306-23467328 GTGGCTATTATTTTTCAAAAGGG - Intergenic
1124618292 15:31258503-31258525 GTGGTTATAATTTTTAAAAAAGG + Intergenic
1126298917 15:47173336-47173358 ATAGCTATTTATTTTAAAGCTGG + Intergenic
1126580787 15:50240755-50240777 GTAGCTATTTATTTTTGAGATGG - Intergenic
1126654659 15:50964069-50964091 TTAGCTATTATTTTTCAATTAGG + Intronic
1127013612 15:54657909-54657931 GTAACTCTTATTATTAAACATGG + Intergenic
1127076895 15:55335621-55335643 GGAGCTGTTATTTTTAAATAGGG + Intronic
1127375318 15:58378978-58379000 GTAGGAATTATTTTAAAAGGGGG - Intronic
1127467815 15:59261532-59261554 GTAGCTATGAATATTAATGATGG - Intronic
1128108976 15:65064568-65064590 ATAGGTATTATTCTTCAAGATGG - Intronic
1128676556 15:69613861-69613883 GCAGATTTTTTTTTTAAAGAAGG - Intergenic
1129595638 15:76961973-76961995 GTAGATGTTATTTTTAAAAAGGG + Intergenic
1130524306 15:84690610-84690632 GTGAATATTTTTTTTAAAGATGG - Intronic
1130929576 15:88413624-88413646 TTAGTTATTATTACTAAAGATGG - Intergenic
1131618672 15:94043687-94043709 GGAGCATTTTTTTTTAAAGATGG + Intergenic
1131949446 15:97665363-97665385 TTAGCTTTTAGTTTTAAAAAAGG - Intergenic
1132010334 15:98269142-98269164 ATAGCTTTTATTTTTTGAGACGG - Intergenic
1132312274 15:100865892-100865914 CTAGCTAATTTTTGTAAAGACGG - Intergenic
1133179084 16:4038978-4039000 GTTGCTATTATTTTTATAAAAGG - Intronic
1133305530 16:4805803-4805825 GTATTTTTTTTTTTTAAAGAAGG - Intronic
1133530144 16:6647738-6647760 GTTGCATTTTTTTTTAAAGATGG + Intronic
1133856430 16:9553600-9553622 GAGGCTATGACTTTTAAAGAAGG - Intergenic
1134156528 16:11848484-11848506 GGAGCTAAGAGTTTTAAAGAAGG - Intronic
1137084627 16:36104175-36104197 CTAGCTAATTTTTGTAAAGATGG + Intergenic
1137741244 16:50777430-50777452 TAACCTATTATTTTAAAAGAAGG - Intronic
1137749445 16:50848441-50848463 GAAAGTATTATTTTTAGAGATGG - Intergenic
1138807720 16:60110532-60110554 CTCTGTATTATTTTTAAAGAGGG + Intergenic
1139210923 16:65075960-65075982 GTACCTATTCTTTTTGAAAAAGG + Intronic
1139256206 16:65545193-65545215 TTAGTTATTATTTTTTAATAAGG + Intergenic
1139663508 16:68438793-68438815 GTAACTATTATTTTGAAGGAGGG - Intronic
1140177626 16:72679514-72679536 GTAGCTATTACTTTAAAAGAGGG + Intergenic
1140265774 16:73419275-73419297 GTAGCTATTATTTATTGATATGG + Intergenic
1142048410 16:87941295-87941317 GTAGTTATTTCTTTAAAAGAAGG - Intergenic
1142451999 16:90179582-90179604 GTAGATATTAATTTTAGATATGG - Intergenic
1144007016 17:11110033-11110055 GTTGCTGTTATTTTTTAAGACGG + Intergenic
1145178059 17:20719198-20719220 GTTGCTATTGTTTTTTGAGACGG + Intergenic
1145192971 17:20862974-20862996 GTAGGTTTTTTTTTTAAATAAGG - Intronic
1145326965 17:21840352-21840374 CTAGCTAATTTTTGTAAAGATGG - Intergenic
1145357936 17:22180701-22180723 GAAGTGATTATTTTTAAGGAAGG - Intergenic
1145403383 17:22564968-22564990 GTAGGTTTTTTTTTTAAATAAGG - Intergenic
1145689947 17:26729534-26729556 CTAGCTAATTTTTGTAAAGATGG - Intergenic
1145693804 17:26771748-26771770 CTAGCTAATTTTTGTAAAGATGG - Intergenic
1146686844 17:34846869-34846891 GTAGCTCTTATTTTTATCGCTGG - Intergenic
1146866871 17:36344328-36344350 TTAGTTTTTATTTTTAGAGACGG - Intronic
1147069740 17:37944937-37944959 TTAGTTTTTATTTTTAGAGACGG - Intergenic
1147081270 17:38024475-38024497 TTAGTTTTTATTTTTAGAGACGG - Intronic
1147097212 17:38148432-38148454 TTAGTTTTTATTTTTAGAGACGG - Intergenic
1147583811 17:41641167-41641189 TTAGCTTTTATTTTTTGAGACGG - Intergenic
1148258705 17:46160228-46160250 GAAGTTATTTTTTTTAAAAAAGG - Intronic
1148260102 17:46174679-46174701 GTTGCTGTTATTTTGAAACAGGG + Intronic
1149341531 17:55691648-55691670 GTAGCTACTATATTTGAAGTGGG - Intergenic
1149748488 17:59122604-59122626 ATAGTTATTATTTTTTGAGATGG - Intronic
1150736034 17:67740306-67740328 ATAAGTATTATTTTTAAAGAGGG - Intronic
1150760475 17:67956613-67956635 GGACCAATTTTTTTTAAAGAAGG + Intronic
1150830610 17:68515260-68515282 GTAGATTTTGTTTTTAAACAGGG - Intronic
1150862476 17:68815658-68815680 GTAGTTTTTGTTTTTAGAGATGG - Intergenic
1151407640 17:73899789-73899811 GTTTTTCTTATTTTTAAAGAGGG - Intergenic
1151462592 17:74263429-74263451 GCAGTATTTATTTTTAAAGATGG - Intergenic
1152148207 17:78582022-78582044 GTTGTTATTATTTTTTGAGATGG - Intergenic
1203191143 17_KI270729v1_random:190936-190958 CTAGCTAATTTTTGTAAAGATGG - Intergenic
1153104963 18:1515998-1516020 ATAGCCATTATTTTTAATGCTGG + Intergenic
1153808097 18:8727706-8727728 GTAGCTACATTTTTTAAAAATGG + Intronic
1154516044 18:15166822-15166844 CTAGCTAATTTTTGTAAAGATGG + Intergenic
1154968410 18:21382467-21382489 GTAGTTATTATTGTTATACATGG + Intronic
1155468274 18:26163461-26163483 GTTGCTATTTTTTATAAATATGG - Intronic
1155808581 18:30204242-30204264 GAATGTATTATTTTTAATGATGG + Intergenic
1156364313 18:36411722-36411744 GTAGTTATTAATTTTCAAAAAGG + Intronic
1157004817 18:43569950-43569972 AAAACTATTATTTTTAAAAATGG + Intergenic
1157268779 18:46252607-46252629 GTAGATTTTTTTTTTAAATATGG + Intronic
1157315602 18:46586748-46586770 ATAGCTGTTGTTTTTAAAAATGG + Intronic
1157371591 18:47117794-47117816 ATATATATTATTTTTAGAGATGG - Intronic
1157414097 18:47487911-47487933 GTAGCTGTTCTTTTTGAGGACGG - Intergenic
1158032288 18:52980306-52980328 GTAGTTGTTTGTTTTAAAGAGGG + Intronic
1158854282 18:61527173-61527195 GTTACTATTATTTTTTGAGATGG - Intronic
1158997836 18:62941443-62941465 GAAGCAATTATTTTTATAGTTGG - Intronic
1159342127 18:67148390-67148412 GTTGTTATTATTTTTAAATCAGG + Intergenic
1159566381 18:70055827-70055849 GTTGGTATTTTTTTTTAAGAGGG - Intronic
1159978395 18:74744888-74744910 GTAGTTTTAATTTTTAAATAAGG + Intronic
1160645486 19:189467-189489 GTAGATATTAATTTTAGATATGG + Intergenic
1162143314 19:8597462-8597484 GTTGCTGTTGTTGTTAAAGATGG + Intronic
1162173640 19:8812778-8812800 TTAGGTATTAATTTTAAAAAAGG + Intronic
1162203651 19:9039520-9039542 TTATTTATTATTTTTTAAGATGG - Intergenic
1162570299 19:11467793-11467815 GTAGCTTTTATTTTAGAAAAAGG + Intronic
1163132918 19:15287413-15287435 GTATTTATTTTCTTTAAAGATGG + Intronic
1163163742 19:15481090-15481112 ATTATTATTATTTTTAAAGATGG + Intronic
1165322497 19:35094730-35094752 GGAGTTATAATTTTTAAACAGGG + Intergenic
1165584161 19:36898243-36898265 GTAGCTATTATATTAATAAATGG - Intronic
1165971277 19:39632789-39632811 ATAGGTTTCATTTTTAAAGAAGG - Intergenic
1166412886 19:42568471-42568493 GTAGATGCTAGTTTTAAAGAGGG - Intergenic
1202669395 1_KI270709v1_random:37374-37396 GTAGCTAATTTTTGTAAAGATGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926645032 2:15281520-15281542 GTAGCTATTATTATTAATTCTGG - Intronic
927142130 2:20137687-20137709 GTGGCTCTTATTATTAAAGCTGG + Intergenic
927406474 2:22775592-22775614 GCAGTTATTATTCTTAATGATGG - Intergenic
927539098 2:23891421-23891443 GTAGCTATTTTTTGAAAAGAAGG + Intronic
927747832 2:25638596-25638618 GTAGCAATTATTTATAGAAAAGG + Intronic
929160349 2:38825887-38825909 GTAGCTGTTGTTTTAAAAGCTGG + Exonic
929300163 2:40294771-40294793 TTAGTTATTGTTTTTAAAGTGGG - Intronic
929417850 2:41761779-41761801 GTAGCCATTTTTTTTAAAGCAGG - Intergenic
930749888 2:54924562-54924584 TTATTTATTATTTTTCAAGATGG + Intronic
930854216 2:55995023-55995045 GTAGTAAATATTTATAAAGATGG - Intergenic
931262521 2:60632570-60632592 GTATTTATTATTTATAAAGACGG + Intergenic
931655553 2:64508308-64508330 CTAGCTAATTTTTGTAAAGATGG + Intergenic
932179295 2:69631419-69631441 GTATCTATTATTATTATAGAAGG - Intronic
932968292 2:76504798-76504820 GTAATTATTAATTTTAAAAATGG + Intergenic
934138657 2:89022830-89022852 ATAGCTTTTATTTTTTAAGATGG + Intergenic
934230590 2:90177730-90177752 ATAGCTTTTATTTTTTAAGATGG - Intergenic
934251895 2:90362479-90362501 CTAGCTAATTTTTGTAAAGATGG + Intergenic
934257542 2:91440477-91440499 CTAGCTAATTTTTGTAAAGATGG - Intergenic
936488384 2:112947020-112947042 GTAGCTATGATTTTTCAGGCAGG - Intergenic
936926513 2:117742352-117742374 GTTGATATTATTTTAAAATATGG - Intergenic
938516380 2:132011838-132011860 CTAGCTAATTTTTGTAAAGATGG + Intergenic
938813489 2:134875573-134875595 TTTGCTTTGATTTTTAAAGACGG + Intronic
939155546 2:138521124-138521146 GTAGTTGGTATTTTAAAAGAAGG + Intronic
939939686 2:148334725-148334747 GTATCTATTATTCATAAAGATGG - Intronic
940622083 2:156124988-156125010 GTTGCTATTATTTGGTAAGATGG - Intergenic
940650819 2:156438530-156438552 GTAGCTATGGTTATTAGAGAAGG + Intronic
940673717 2:156703276-156703298 GGAGCTATTAATTTTACAAATGG - Intergenic
940750861 2:157625970-157625992 GTTGCTCTTGTTTTTAGAGACGG + Intronic
940798765 2:158109315-158109337 GTAGCAAAAATTTTTAAATATGG - Intronic
941141605 2:161789512-161789534 GTAGCTTTTTTTTTTCAAGATGG - Intronic
941893671 2:170608201-170608223 GTAACTATTCTTTTTTGAGACGG - Intronic
942749582 2:179272747-179272769 GTAGAGATTATTTTTAAATGTGG - Intergenic
942946127 2:181676149-181676171 GTAACAATCATTTTTAAAAATGG + Intronic
943419306 2:187650370-187650392 GTACTTATTGTTTTTACAGATGG - Intergenic
943738861 2:191389174-191389196 GTAGACATTATTTTTATAAATGG + Intronic
943772281 2:191731539-191731561 TTATCTTTTTTTTTTAAAGATGG + Intergenic
944186908 2:196959138-196959160 GTAGCTATTTTTCTTCAAAATGG + Intergenic
944279597 2:197880105-197880127 GTAGCTTTTATTTCTAAGGTTGG - Intronic
945263317 2:207865263-207865285 ATAGCAGTTATTTTAAAAGAGGG - Intronic
949083425 2:242124140-242124162 GTAGATATTAATTTTAGATATGG - Intergenic
1168914905 20:1477677-1477699 GTTACTATTATTTTTTGAGACGG + Intronic
1169030636 20:2404045-2404067 GTAGCTATTATTATTACAAATGG - Intronic
1170942485 20:20859975-20859997 GTTGCTTATATTTTTAAAAATGG + Intergenic
1170974724 20:21151265-21151287 GTAGCTAATACCTTTAAAAAAGG - Intronic
1171476639 20:25414694-25414716 TTATTTATTATTTTTAAAGATGG - Intronic
1172266045 20:33615160-33615182 GTGGCCTTTATTTTTAGAGATGG - Intronic
1173131996 20:40402640-40402662 CTAGCCATTATATTGAAAGAGGG - Intergenic
1173153533 20:40588176-40588198 GTAGGTATCATCTTTACAGATGG - Intergenic
1174132007 20:48351785-48351807 TTATTTATTATTTTTAGAGATGG + Intergenic
1174303490 20:49599213-49599235 TTATTTATTATTTTTAGAGATGG - Intergenic
1174890612 20:54388124-54388146 TTAGTTATTATTTTTAATGATGG + Intergenic
1176280019 20:64296764-64296786 GTAGATATTAATTTTAGATATGG - Intergenic
1177310475 21:19386081-19386103 TTAGCTATTATTTATTAAAATGG - Intergenic
1177535834 21:22425573-22425595 ATTGCTATTATTTTTAAATTTGG + Intergenic
1177550940 21:22621578-22621600 GAATCTATTATTTTTAACGTAGG + Intergenic
1178203604 21:30437295-30437317 GTATCAATTATTTTTAATTAAGG - Intergenic
1178223003 21:30682487-30682509 GTAGCTATATTTTAAAAAGATGG - Intergenic
1179201696 21:39229289-39229311 GTATGTATTATTTTTTAAAATGG - Intronic
1179624221 21:42639230-42639252 GTATATATTATTTTTTGAGACGG - Intergenic
1181103663 22:20558534-20558556 GTAGAAATTATTTTTAAAGTCGG - Intronic
1181146995 22:20855845-20855867 GTAACTATTAGTAATAAAGATGG - Intronic
1181154669 22:20911946-20911968 GTAGCTATTATTTTTTGATACGG + Intergenic
1182324251 22:29499929-29499951 GAGGCTTTTTTTTTTAAAGATGG - Intergenic
1182561977 22:31167078-31167100 GTAGTTTTGATTTTTAAATAAGG + Intronic
1182938580 22:34251617-34251639 ATAGCTCTTATTTTGAAATATGG + Intergenic
1184573462 22:45342477-45342499 GTAGCTATTACATTTTAAAATGG + Intergenic
1185358689 22:50391593-50391615 CTGGATTTTATTTTTAAAGATGG - Intronic
949208820 3:1473738-1473760 GTTGGTATTATTTGTAAAGATGG - Intergenic
950171294 3:10840651-10840673 GTAGCTTTAATTTGTTAAGAAGG + Intronic
950191536 3:10980084-10980106 GTAATTAATATTTTTAAAGAGGG + Intergenic
950633128 3:14297534-14297556 GTTGCAATCAGTTTTAAAGAGGG + Intergenic
951636274 3:24781766-24781788 GTAGCTTTTATGTTTACAGATGG + Intergenic
951825233 3:26860836-26860858 GGAGCCATCATTTTTAAAAATGG + Intergenic
951901584 3:27662915-27662937 GTAGCTATTATTTTTACCTGGGG + Intergenic
952140346 3:30471914-30471936 TTAGCAATGATTTTGAAAGAAGG - Intergenic
952214225 3:31260369-31260391 GTATCTTTTATTTTTTGAGAGGG - Intergenic
952593924 3:34990914-34990936 GAATCTATTTTTTTTAAAGATGG + Intergenic
953966769 3:47313818-47313840 GTAGCTATTATGTGAAGAGAAGG - Intronic
953978624 3:47401611-47401633 GTGGCTCTTAATTTTAAAAATGG + Intronic
954534403 3:51348112-51348134 GTATATATTTTTTTTAAAGGAGG + Intronic
956817985 3:72925878-72925900 CTCTTTATTATTTTTAAAGAGGG - Intronic
956912180 3:73829381-73829403 ATCGGGATTATTTTTAAAGAAGG + Intergenic
957027942 3:75205959-75205981 ATTGCTTTTATTTTTAAAAAAGG - Intergenic
957119891 3:76076475-76076497 ATAGACATTATTTTTATAGAGGG + Intronic
957553451 3:81735985-81736007 GTAGCTATCATTTTCATAGTAGG - Intronic
957782966 3:84843443-84843465 GTAGCTAAGATTATTAATGAAGG + Intergenic
957986423 3:87577362-87577384 ATTGCTAATTTTTTTAAAGAGGG + Intergenic
957997890 3:87713685-87713707 TTAGATATTAATTTTAAAAAAGG + Intergenic
958566503 3:95818459-95818481 GTAGAAATTATTTGTAAAGTTGG - Intergenic
958979402 3:100703863-100703885 ATAGCTATTATTTATTACGAAGG + Intergenic
959132424 3:102373527-102373549 TTAACCATTATTTTAAAAGATGG - Intronic
959288932 3:104448401-104448423 TTAGATTTTCTTTTTAAAGAGGG + Intergenic
960048733 3:113221217-113221239 GTAGCTGTTATTATTAGGGAAGG + Intronic
960256893 3:115520083-115520105 GTATTTATTATTTTTTTAGATGG - Intergenic
961199129 3:125029886-125029908 GAAGTTATTATTTTTTAAGATGG - Intronic
962653041 3:137515524-137515546 ATTGTTATTATTTTTATAGATGG + Intergenic
962858623 3:139374793-139374815 GTAACTATCACATTTAAAGAAGG + Intronic
963080468 3:141388406-141388428 GGAGTTACAATTTTTAAAGAGGG + Intronic
963082661 3:141409047-141409069 TTAATTATTATTTTTTAAGACGG + Intronic
964041568 3:152268143-152268165 TAACATATTATTTTTAAAGAGGG + Exonic
964269328 3:154938854-154938876 ATAACTATTTTATTTAAAGAGGG - Intergenic
964457934 3:156888922-156888944 GTAGCTCTTATTTTCTAAAAAGG + Intronic
964815051 3:160708127-160708149 GTAGCTAACATTTTCACAGAGGG - Intergenic
964832738 3:160903604-160903626 GTAGCTATTATTTTTAAAGATGG + Intronic
965107416 3:164375122-164375144 ATGGTTATTATTTTTAAAAAGGG - Intergenic
965218325 3:165893702-165893724 TTATCTATTACTTCTAAAGAAGG - Intergenic
965261173 3:166488536-166488558 GTAGTTATTATTTTAAAATATGG + Intergenic
965478502 3:169186870-169186892 GCAGATATTATTTGTAAATAGGG + Intronic
965914835 3:173831044-173831066 GAAAATATTATTTTTAAAGGGGG - Intronic
966178539 3:177166215-177166237 ATTGTTATTATTTTTAGAGATGG - Intronic
966274198 3:178144977-178144999 GTTCCTATTTTTTTTATAGATGG + Intergenic
967793172 3:193570919-193570941 GTAGCTATTATTATTATTAAAGG + Intronic
968095781 3:195929436-195929458 GAAGCTTTTATTTTTTGAGATGG - Intergenic
968372197 3:198230059-198230081 GTAGATATTAATTTTAGATATGG - Intergenic
969286123 4:6203022-6203044 ATTGTTATTATTTTTTAAGATGG + Intergenic
969960675 4:10941698-10941720 GTAGTTATTATTATTAGACATGG + Intergenic
970014207 4:11494720-11494742 TTAAGTATTATTTTTAAATAGGG - Intergenic
970709769 4:18848334-18848356 CTATCTTTTTTTTTTAAAGATGG - Intergenic
970954349 4:21793252-21793274 GTAGTTATTCTTTTTTGAGATGG + Intronic
970987278 4:22173146-22173168 GTATCAATTATTTTTTAAGAAGG - Intergenic
971169951 4:24223715-24223737 ATAGTTACTATTTTTAATGATGG - Intergenic
972397134 4:38667072-38667094 GCAGCTCTTATTTGTAAATAGGG + Intronic
972447537 4:39159823-39159845 GTAGGTAGTATTTTTATAGGTGG - Intergenic
972705071 4:41534263-41534285 TGAGCTATAATTTTTAAAAATGG - Intronic
972903413 4:43713745-43713767 GTAGATAACATTCTTAAAGATGG + Intergenic
973039738 4:45455582-45455604 GCAATTATTATTTTTAAAAAAGG - Intergenic
973095862 4:46198601-46198623 GTAGCTATTATTATCAAATTGGG + Intergenic
973104948 4:46323977-46323999 GAGGCTTTTATTTTTAAAGATGG - Intronic
973966082 4:56163289-56163311 TTAGCTTTTTTTTTTGAAGACGG - Intergenic
973980333 4:56303382-56303404 ATATATATTTTTTTTAAAGATGG + Intronic
974383517 4:61174229-61174251 GTATCTATTTTTTTTAAGGATGG - Intergenic
974395810 4:61333784-61333806 GTATTTATTTTTTGTAAAGAGGG + Intronic
974719641 4:65721825-65721847 TAAGCTATTATTTTAAAAGGAGG + Intergenic
975494526 4:75023422-75023444 TTAGCTATTATTATTACAGTTGG + Intronic
975515410 4:75242505-75242527 ATAGCTTGTATTTTAAAAGATGG + Intergenic
975795407 4:78001494-78001516 ATAGGTTTCATTTTTAAAGAGGG + Intergenic
975830595 4:78364154-78364176 GTAGCCTTTATTTTTATAAAAGG + Intronic
975834233 4:78404795-78404817 GTAGCTAAGATTTATATAGATGG - Intronic
975871547 4:78784670-78784692 GTAAGTATTATTTTAAAATATGG + Intronic
976155691 4:82142195-82142217 GTTGCTATTTTTTTTAACAATGG - Intergenic
976194103 4:82516604-82516626 GAAGCTATTATTGTTATAAATGG + Intronic
976742942 4:88375962-88375984 CCAGCTATTTTTTGTAAAGATGG + Intergenic
976753294 4:88472124-88472146 GTGGCTATTTTTTTTAAACTGGG + Intronic
976987272 4:91317410-91317432 GTAGCTTATAATTTTAAATAGGG - Intronic
976987543 4:91320839-91320861 GAACCTATTATCTTTCAAGAGGG - Intronic
978010830 4:103682135-103682157 GTCATTATTATTTTTAGAGATGG + Intronic
978508717 4:109491670-109491692 GTAGTTATTCTTTAAAAAGAAGG - Intronic
978513959 4:109551896-109551918 GTTTCTATTATTTTTAAAAGTGG + Intergenic
979080427 4:116332144-116332166 TTATCTAATCTTTTTAAAGATGG - Intergenic
979260880 4:118642539-118642561 GTAGATATTAATTTTAGATATGG - Intergenic
979457015 4:120938513-120938535 TTGACTATTAATTTTAAAGAGGG + Intergenic
979477058 4:121170818-121170840 ATATCTTTTTTTTTTAAAGAAGG + Intronic
979704175 4:123701315-123701337 GAAGATATAATTTTTAAGGAGGG - Intergenic
980874423 4:138646603-138646625 CTCTCTATTATCTTTAAAGAGGG - Intergenic
981361967 4:143856838-143856860 GTAACTATTATTTTTAAATTGGG + Intergenic
981372704 4:143977735-143977757 GTAACTATTATTTTTAAATTGGG + Intergenic
981381795 4:144080955-144080977 GTAACTATTATTTTTAAATTGGG + Intergenic
981689579 4:147492272-147492294 TTACCTAATATTTTTAAAGCTGG - Intronic
981950201 4:150396972-150396994 TTAGTTATTATTTTTAATAATGG - Intronic
982278489 4:153660629-153660651 CTAGCTATTATTTTCAAGAAAGG - Intergenic
982493313 4:156057562-156057584 GTAGATTTTATTTTTTAAAAAGG - Intergenic
983092174 4:163516942-163516964 GTACCTTTTATTGTTAAAAAAGG + Intronic
983220464 4:165039053-165039075 ATTGCTATTATTTTTTGAGATGG - Intronic
983366972 4:166803924-166803946 GTAGCTATTAAAGTTAGAGAAGG - Intronic
983580340 4:169303611-169303633 GTAGCCAGTATTTTTAACTATGG + Intergenic
983604364 4:169569270-169569292 TTAGATTTTATTTTTAAAAATGG + Intronic
983627184 4:169813842-169813864 GTAGCTATTTTGGTTAAGGAAGG - Intergenic
983923048 4:173368243-173368265 GTTGCTACTGTTTTGAAAGAAGG - Intergenic
984747303 4:183234109-183234131 ATAGGTTTTATTTTAAAAGAAGG - Intronic
984799923 4:183705292-183705314 ATAGCCATTATTTTTAAAACAGG - Intronic
985047506 4:185955030-185955052 GTAGTTATTTTTCTAAAAGAAGG - Intronic
986865709 5:11984069-11984091 ATATTTATAATTTTTAAAGAGGG + Intergenic
988189744 5:27913867-27913889 ATAGCCATTATCTTTATAGAGGG + Intergenic
988729880 5:33961620-33961642 ATTGCTTTTAGTTTTAAAGAGGG - Intronic
989048859 5:37298404-37298426 GTGGCTATAATTTTTAAATAAGG - Intronic
990136519 5:52651277-52651299 GTACATAATGTTTTTAAAGAAGG + Intergenic
990583082 5:57183731-57183753 ATAGCTAATATTTTTTAATACGG + Intronic
993164919 5:84340460-84340482 GTAGCTATTATTATTACCCATGG + Intronic
993562601 5:89429530-89429552 GTAATTATTATTTTTTGAGATGG + Intergenic
994065199 5:95532007-95532029 GTAGCTATTTTTTTTTAGGATGG - Intronic
994083959 5:95738507-95738529 GATGCTATTATCTTTAAAGTGGG + Intronic
994218876 5:97171550-97171572 GTGGCTATTTTTTTAATAGATGG - Intronic
994343262 5:98656786-98656808 GTTTCTATTATTTTTAAAATGGG + Intergenic
994805723 5:104445577-104445599 ATAGACATTATTTTTAAAAAGGG + Intergenic
995079882 5:108037415-108037437 CTAGCGATTATTTTCAAAGAAGG + Intronic
995617741 5:113985491-113985513 ATAGATCTTATTTATAAAGAGGG + Intergenic
997152050 5:131508078-131508100 GGAGCTATTATTCTTGAAGATGG - Exonic
998313665 5:141159072-141159094 CTATATATTATTTTAAAAGAAGG - Intergenic
999131763 5:149289010-149289032 GTAGGGATTATTGTTAGAGATGG - Intronic
999341354 5:150776556-150776578 GTAGATATGATTCTTAAAGAGGG + Intergenic
999359721 5:150973216-150973238 ATAGAAATTATTTTTAAAAATGG + Intergenic
999950153 5:156640426-156640448 ATATCTGTTATTTTTAAAAATGG + Intronic
1000776217 5:165423561-165423583 TTAGCTATTATTAGTAAAGCAGG - Intergenic
1000919562 5:167122016-167122038 ATAGCTATTTTTTTTCCAGATGG + Intergenic
1000942710 5:167382154-167382176 GTAGCTAAAGTTTTTAAAGTAGG - Intronic
1001606683 5:172965365-172965387 TTATTTTTTATTTTTAAAGAAGG - Intronic
1002731438 5:181335609-181335631 GTAGATATTAATTTTAGATATGG - Intergenic
1002753102 6:138481-138503 GTAGATATTAATTTTAGATATGG + Intergenic
1003530257 6:6930995-6931017 TTAGTTATTATTTTTAGAGATGG + Intergenic
1005139858 6:22617187-22617209 GTGGTTTTTATTTTTAATGAAGG - Intergenic
1005493386 6:26367971-26367993 ACAGATATTATTTTTACAGATGG + Exonic
1005502622 6:26443363-26443385 ACAGATATTATTTTTACAGATGG + Exonic
1005916461 6:30356339-30356361 GTTTTTCTTATTTTTAAAGACGG - Intergenic
1006829988 6:36962774-36962796 GTAACTTTTATTTTCAATGAGGG + Intronic
1006917851 6:37607079-37607101 GGAGCTTTCTTTTTTAAAGAAGG + Intergenic
1007167375 6:39838333-39838355 ATTGCTATTATTATTGAAGATGG + Intronic
1007594625 6:43043855-43043877 TTATTTCTTATTTTTAAAGATGG - Intronic
1007872385 6:45054983-45055005 GTTGCTATTATGCTTAAACATGG - Intronic
1008368143 6:50706415-50706437 TTGGCTATTATTTGAAAAGAGGG - Intergenic
1008449753 6:51636545-51636567 GTTGTTGTTATTTTTAGAGAGGG - Intronic
1008781008 6:55104972-55104994 GAAACTATCATTTTTAAATATGG - Intergenic
1010764947 6:79768434-79768456 TTGGCTATAATTTTTAAAAAGGG + Intergenic
1010800989 6:80175457-80175479 GAAGCTATAAATTTTAAGGAGGG + Intronic
1011015639 6:82751675-82751697 GTTGCTATTTTTTTGAAGGATGG - Intergenic
1011802429 6:91032053-91032075 GTAGCTATTAATTTTCAGTAAGG - Intergenic
1012352801 6:98273867-98273889 ATGCTTATTATTTTTAAAGAGGG + Intergenic
1012749339 6:103138190-103138212 GTAAATATTAATTTTATAGAAGG + Intergenic
1013072341 6:106740644-106740666 GTGGCTTTTATTTTAAGAGATGG + Intergenic
1013218121 6:108049172-108049194 GTAGCTATCATTTCTAAAACAGG + Intronic
1013517459 6:110901265-110901287 GTTACTTTTATTTTTTAAGACGG - Intergenic
1014349165 6:120317634-120317656 GTAGCCATTATTTTGAGAAAAGG + Intergenic
1014717360 6:124881788-124881810 GTTGCTTTTCTTTGTAAAGAAGG - Intergenic
1015950193 6:138545335-138545357 GTAGCTAAAAGTTTAAAAGAAGG - Intronic
1016530791 6:145056242-145056264 GTATTTATTATTGTTAAGGAGGG - Intergenic
1017419717 6:154261194-154261216 CTGGCTATTTTTTGTAAAGATGG + Intronic
1017532683 6:155312525-155312547 GTAGCTCTCCATTTTAAAGAAGG - Intronic
1017610572 6:156182096-156182118 GTAGCTGTTTTTTCTTAAGAAGG + Intergenic
1018371464 6:163172133-163172155 GCAGTTATTATTTTAAAACAAGG + Intronic
1020442942 7:8238309-8238331 ATGGCTATTATTTTTAAAAATGG - Intronic
1022425466 7:30264820-30264842 GTAACTATTTTTTTAAAAAAAGG - Intergenic
1022553660 7:31269346-31269368 ATGGCTATAATTTTTAAAAAGGG - Intergenic
1022632497 7:32098415-32098437 TTTCCTATTATTTTTAATGAAGG - Intronic
1022741579 7:33127327-33127349 GTACGAATTTTTTTTAAAGATGG - Intergenic
1023381266 7:39610798-39610820 GTAGGTATTATTGTTAAATATGG + Intergenic
1024076586 7:45822785-45822807 GTAGATATTAATTTTAGATATGG - Intergenic
1024186217 7:46950891-46950913 GTAGCTATTATTTTGTAAAGAGG + Intergenic
1024472819 7:49781244-49781266 GTGACTTTTTTTTTTAAAGAGGG + Intronic
1024901775 7:54326149-54326171 ATACCTATTATTTTAAAACAAGG - Intergenic
1025059613 7:55794230-55794252 GTAGATGTTATTTTTAAATATGG + Exonic
1025127832 7:56358643-56358665 GTAGATATTAATTTTAGATATGG + Intergenic
1025478217 7:60953953-60953975 CTAGCTAATTTTTGTAAAGATGG - Intergenic
1025615863 7:63115791-63115813 GTAGATATTATTTTTAGATATGG + Intergenic
1026075785 7:67166541-67166563 ATAGCAATTATTTTTAGAGAGGG - Intronic
1026527700 7:71169724-71169746 TTTGCTATTATTTGTAGAGACGG + Intronic
1026640288 7:72118186-72118208 CTAGCTATCATTCTTAAAGAAGG + Intronic
1026701070 7:72645747-72645769 ATAGCAATTATTTTTAGAGAGGG + Intronic
1026781619 7:73271828-73271850 GAAATTATTATTTTTAGAGACGG + Intergenic
1027282169 7:76616849-76616871 GTAGCTTTTATTTTTTGAGTTGG - Intronic
1027641727 7:80742506-80742528 CTAGCTTTTATTTTTAATGTAGG - Intergenic
1027876714 7:83779382-83779404 GTATCTATTTTTTTAAAAAAAGG + Intergenic
1028902488 7:96117271-96117293 CTAGTTATTATTTTGAAGGATGG - Intergenic
1029742360 7:102498067-102498089 TTAACTATTTTTTTTAGAGATGG + Intronic
1029760350 7:102597232-102597254 TTAACTATTTTTTTTAGAGATGG + Intronic
1030091443 7:105862262-105862284 TTTTCTATTATTTTTAGAGACGG - Intronic
1030351694 7:108496323-108496345 GTATCTCATATTTTTAAAAAAGG + Intronic
1030950258 7:115782145-115782167 ACAGCTATTATTTTTAACAAGGG - Intergenic
1031224809 7:119022241-119022263 ATAGATATTATTTTATAAGAAGG + Intergenic
1031851638 7:126871815-126871837 GTATCTATAATTCTTAGAGATGG - Intronic
1032098820 7:128955735-128955757 GTCGATTTTATTTTGAAAGAAGG + Intronic
1032208457 7:129890381-129890403 ATATATATTTTTTTTAAAGATGG + Intronic
1032500717 7:132397800-132397822 TTAGCTATTGCTTTTAAATAAGG - Intronic
1032778975 7:135147058-135147080 GTAGCTATTATTATGAAAAGTGG - Intronic
1033021732 7:137732113-137732135 CTAGCTAATATTTATATAGATGG - Intronic
1034197569 7:149260071-149260093 GTGGCTTTTTTTTTTTAAGACGG - Intergenic
1034623169 7:152471923-152471945 GTAGCTATTTTTAGTAGAGATGG - Intergenic
1034914729 7:155027448-155027470 GTTGCAGTTGTTTTTAAAGATGG - Intergenic
1035512076 8:198673-198695 GTAGATATTAATTTTAGATATGG + Intronic
1035830921 8:2693663-2693685 TTATTTATTATTTTTAGAGAAGG + Intergenic
1036579366 8:10058791-10058813 GTAGAATTTATTTTTAAAGGTGG - Intronic
1037054805 8:14426326-14426348 GTAGGGAATATTTTTAAATAGGG + Intronic
1037317652 8:17613852-17613874 GTAGCTTTTCTTTTTTGAGATGG - Intronic
1037419558 8:18687769-18687791 TTTGCTATTTTTTTTTAAGATGG + Intronic
1037448184 8:18989034-18989056 GTAGGTATTCTTTTTTCAGACGG + Intronic
1038502237 8:28054876-28054898 ATTATTATTATTTTTAAAGATGG - Intronic
1038791325 8:30670925-30670947 GTTGTTATTATTTTTTGAGAGGG + Intergenic
1038829217 8:31038241-31038263 ATAGCTATAATTTTTAAAAAAGG - Intronic
1038889448 8:31702636-31702658 GTTGCTATTATTGTTGAAGGAGG + Intronic
1038955702 8:32466130-32466152 GTATGTATTATTTGTAAAGATGG - Intronic
1039005735 8:33035060-33035082 TTATCTATTCTTTTTAAAGATGG + Intergenic
1041178509 8:55222810-55222832 ATAGCTAATATATTTAAAGGAGG + Intronic
1041442697 8:57914607-57914629 GTAGCTATGAATTTTTAAGAGGG - Intergenic
1041542854 8:59006684-59006706 TTAGATATTATCTTTAAAGAAGG - Intronic
1041736061 8:61111760-61111782 ATAGCCAATTTTTTTAAAGAAGG - Intronic
1041990127 8:63977600-63977622 TTAGCTTTTATTTTTGATGAAGG + Intergenic
1042209710 8:66367806-66367828 CTAGCTATTCTTCTTAAAAATGG - Intergenic
1042387230 8:68190804-68190826 GTATCTATTTTTTTTAGTGATGG - Intronic
1042799801 8:72706249-72706271 GTAGCAATTATTTTTAATTGTGG - Intronic
1042909848 8:73815204-73815226 GTTACTATTTTTTTTAGAGATGG - Intronic
1043019099 8:74978767-74978789 GTAAATATTTCTTTTAAAGAAGG - Intergenic
1043314664 8:78905627-78905649 GTTGTTATTATTTGTGAAGAAGG + Intergenic
1043392878 8:79808508-79808530 GTTGCTTTTATCTTTGAAGAGGG + Intergenic
1043651948 8:82606830-82606852 ATAGTTAATATTTTTAAAGTTGG - Intergenic
1044025140 8:87159870-87159892 GTAGCATTTATATTTAAAGGGGG + Intronic
1044588180 8:93887474-93887496 CAAGCTAATATTTTTAAATACGG - Intronic
1045535918 8:103027681-103027703 GTAACAATTATTTTTCAACATGG - Intronic
1045628654 8:104088046-104088068 TTAGCTATGACTTCTAAAGAGGG - Intronic
1046146277 8:110164262-110164284 ATAGCTATTATTTGTAAATGAGG - Intergenic
1046345471 8:112920038-112920060 GTGGTTATTATTTTTAATAATGG - Intronic
1047081430 8:121465692-121465714 GTTGAAATTATTTTTAAAAAAGG + Intergenic
1047315943 8:123732999-123733021 CCAGCTAATTTTTTTAAAGACGG - Intronic
1047582550 8:126232185-126232207 GCAGCTTTTATATTTAAAAAAGG - Intergenic
1047597985 8:126397740-126397762 GTAGCTAATTTTTGTAGAGACGG + Intergenic
1048089753 8:131226600-131226622 GGAGTTAACATTTTTAAAGATGG - Intergenic
1048380970 8:133864433-133864455 GTAGCTATAATATTTCAGGAAGG + Intergenic
1048522196 8:135167003-135167025 GTAGCTACTATTTTTGAATTAGG - Intergenic
1049139239 8:140936715-140936737 GTTGCTATGATTTTTAAGCATGG + Intronic
1049760073 8:144328078-144328100 GTTGTTATTTTTTCTAAAGATGG + Intergenic
1050250481 9:3738690-3738712 ATAGCTACTACTTTTTAAGAGGG + Intergenic
1051300022 9:15639392-15639414 GTAGAGATAATTTTTAAAGAAGG + Intronic
1051835478 9:21333216-21333238 ATAGATTTTATTTTCAAAGACGG + Exonic
1052022388 9:23540342-23540364 GTGATTATTATCTTTAAAGAAGG - Intergenic
1055982613 9:82019510-82019532 ATAGCTATTATCTTTCAAGAAGG - Intergenic
1056408473 9:86300167-86300189 TTATCTATTATTTTTAGAGTAGG - Intronic
1056430730 9:86525499-86525521 TCTGCTATTATTTTTTAAGAAGG + Intergenic
1057026197 9:91735531-91735553 GCAGCTAGCATTTTAAAAGATGG + Intronic
1057710331 9:97435627-97435649 GTAGCTTTTTTTTTTTAAGAGGG - Intronic
1057788621 9:98107669-98107691 GTAGATTTTTTTTTTTAAGATGG + Intronic
1057993268 9:99795581-99795603 TTAGTTTTTTTTTTTAAAGATGG - Intergenic
1058126031 9:101196085-101196107 GTTGATATTATATTCAAAGAGGG - Intronic
1058162339 9:101582991-101583013 GTAGTTATTGTTTTTAAATTTGG + Intronic
1058203327 9:102070680-102070702 GAAGCTATGATTTGTAAAGGAGG - Intergenic
1058581374 9:106461921-106461943 GTTGGTATTATGTATAAAGAAGG - Intergenic
1058624519 9:106920984-106921006 GTAGCTATTCCTTTTAAAGGAGG - Intronic
1058789709 9:108430720-108430742 GTAGCTATTAATCTTATTGAGGG - Intergenic
1059847615 9:118298444-118298466 GTAGCTATTAATATTATTGAAGG + Intergenic
1060004124 9:119984457-119984479 TTATTTATTATTTTTAAAGCAGG - Intergenic
1061031913 9:128090128-128090150 CTAGCTTTTATTTGTGAAGACGG - Intronic
1061171475 9:128959158-128959180 GTAACTTTTTTTTTTTAAGATGG + Intronic
1061465267 9:130773463-130773485 GTTGCTATTGTTTTGAAATAGGG + Intronic
1061772431 9:132936285-132936307 GTTTCTTTTAGTTTTAAAGATGG + Intronic
1062755843 9:138288113-138288135 GTAGATATTAATTTTAGATATGG - Intergenic
1185476354 X:417906-417928 ATAGTTATTATTTTTTGAGATGG + Intergenic
1185630206 X:1511327-1511349 GGAGCTATGAATTTTAATGAAGG - Intronic
1185969985 X:4651971-4651993 GTAGCTTTTATTCTAAAGGATGG - Intergenic
1186351324 X:8742600-8742622 CCAGCCATGATTTTTAAAGAGGG - Intergenic
1187356271 X:18574885-18574907 GTAGCTGATGTTTTTAAGGATGG - Intronic
1187481782 X:19663289-19663311 GTGGTTGTTATTTTTTAAGAGGG + Intronic
1187709851 X:22042263-22042285 ACAGCTCTTATTTTGAAAGAGGG - Intronic
1188168765 X:26894460-26894482 TTTTCTATTATTTTTGAAGAAGG - Intergenic
1188254863 X:27949413-27949435 GAAATAATTATTTTTAAAGAAGG - Intergenic
1188588738 X:31808157-31808179 GCAGGTATTATTTTTGAAAATGG + Intronic
1188684096 X:33047913-33047935 GTAGGGATTAGTTTTAAATAGGG + Intronic
1188875942 X:35430267-35430289 GTAGATATAATTTTGAAATAAGG + Intergenic
1190037281 X:47037415-47037437 GTATCTATTATGTTAAGAGATGG - Intronic
1190127453 X:47719502-47719524 ATTACTATTATTTTTAGAGACGG - Intergenic
1190851526 X:54248333-54248355 ATAACTTTTTTTTTTAAAGAAGG + Intronic
1192022823 X:67412347-67412369 ATAGCTATTATTTTTCAAAAAGG - Intergenic
1192033625 X:67541961-67541983 GTTATTTTTATTTTTAAAGATGG - Intergenic
1192775959 X:74244866-74244888 TAAGCTATTATTTTTAATGTAGG - Intergenic
1193581376 X:83267519-83267541 GTAGCCATGTTTTTAAAAGATGG - Intergenic
1193634497 X:83931442-83931464 GTAGTAAATAATTTTAAAGATGG + Intergenic
1194803368 X:98298369-98298391 GTGGGTTTTATTTTTACAGAGGG + Intergenic
1194825604 X:98559073-98559095 TTAGCTATTATTAAAAAAGAAGG - Intergenic
1195927361 X:110039192-110039214 GTAGTTGTTATTATTAAAGCAGG + Intronic
1196121469 X:112055613-112055635 TTATATATTATTTTTAAATATGG + Intronic
1196749857 X:119106197-119106219 GTAATTATTATTATTAAAGCTGG - Intronic
1198016188 X:132613686-132613708 GTTGCTATTGCTTTTAATGAGGG - Intergenic
1198233007 X:134711020-134711042 GCATTTTTTATTTTTAAAGAAGG + Intronic
1198387025 X:136138650-136138672 TTAGCTATTTTTTTTTGAGACGG - Intergenic
1198505771 X:137299973-137299995 GTAGATATAATTTTTTAAAAAGG + Intergenic
1198562580 X:137866820-137866842 TTTATTATTATTTTTAAAGATGG - Intergenic
1198620041 X:138497566-138497588 GTACCTAATATTTTGAAAAATGG + Intergenic
1198622082 X:138524051-138524073 GTATTAATTATTTTTAAATATGG - Intergenic
1199050432 X:143230850-143230872 GTGACTGTTATGTTTAAAGATGG - Intergenic
1199362701 X:146941933-146941955 GTATTTATTAATTTTAAAGTAGG + Intergenic
1201414554 Y:13735210-13735232 CTAGCCATGATTTTTAAAGTAGG + Intergenic
1202093592 Y:21220083-21220105 GAAGCTTTTATTTTTTGAGATGG - Intergenic
1202382353 Y:24284941-24284963 GTAGATATTAATTTTAGATATGG - Intergenic
1202488431 Y:25385184-25385206 GTAGATATTAATTTTAGATATGG + Intergenic