ID: 964835223

View in Genome Browser
Species Human (GRCh38)
Location 3:160930632-160930654
Sequence GTTCCTTTGAGGCTTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964835223_964835228 5 Left 964835223 3:160930632-160930654 CCAGGCTGAAGCCTCAAAGGAAC 0: 1
1: 0
2: 4
3: 14
4: 121
Right 964835228 3:160930660-160930682 CAAAATTTTAGGCGGAGTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 134
964835223_964835231 30 Left 964835223 3:160930632-160930654 CCAGGCTGAAGCCTCAAAGGAAC 0: 1
1: 0
2: 4
3: 14
4: 121
Right 964835231 3:160930685-160930707 TTTAAGAGGGAAGCTTCGTATGG 0: 1
1: 0
2: 0
3: 7
4: 101
964835223_964835229 16 Left 964835223 3:160930632-160930654 CCAGGCTGAAGCCTCAAAGGAAC 0: 1
1: 0
2: 4
3: 14
4: 121
Right 964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG 0: 1
1: 1
2: 0
3: 7
4: 108
964835223_964835226 -3 Left 964835223 3:160930632-160930654 CCAGGCTGAAGCCTCAAAGGAAC 0: 1
1: 0
2: 4
3: 14
4: 121
Right 964835226 3:160930652-160930674 AACCATCTCAAAATTTTAGGCGG 0: 1
1: 0
2: 1
3: 14
4: 221
964835223_964835230 17 Left 964835223 3:160930632-160930654 CCAGGCTGAAGCCTCAAAGGAAC 0: 1
1: 0
2: 4
3: 14
4: 121
Right 964835230 3:160930672-160930694 CGGAGTGAAGGAGTTTAAGAGGG 0: 1
1: 3
2: 9
3: 18
4: 177
964835223_964835225 -6 Left 964835223 3:160930632-160930654 CCAGGCTGAAGCCTCAAAGGAAC 0: 1
1: 0
2: 4
3: 14
4: 121
Right 964835225 3:160930649-160930671 AGGAACCATCTCAAAATTTTAGG 0: 1
1: 1
2: 2
3: 23
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964835223 Original CRISPR GTTCCTTTGAGGCTTCAGCC TGG (reversed) Intronic
900377192 1:2360455-2360477 GTTCTTTTAAGGCAGCAGCCAGG - Intronic
900577790 1:3392463-3392485 GTTCCTTTTAGTCTGCAGTCCGG + Intronic
902825787 1:18973288-18973310 GGTCCTCTGCGGCTTGAGCCTGG + Intergenic
910667504 1:89741010-89741032 GGTCCTCTCAGGCTTAAGCCAGG + Intronic
911308286 1:96259462-96259484 GTGCCTCTGGGGCTTCAGGCTGG + Intergenic
912589822 1:110805694-110805716 GTTTTTTTTAGGCTTCATCCTGG - Intergenic
914901262 1:151712372-151712394 ATTCTTTTGAGGGTACAGCCTGG + Intronic
915068796 1:153248371-153248393 GTTCCTCTGAGATCTCAGCCTGG + Intergenic
918547465 1:185701073-185701095 GTTTCTCTCTGGCTTCAGCCTGG + Intergenic
923020605 1:230160437-230160459 GTTCTTTTGAGTCTTCTGCTAGG - Intronic
1066446307 10:35486887-35486909 GTTTCTTTGATCCCTCAGCCTGG + Intronic
1069852481 10:71419104-71419126 GTTCCTCTGTGGCCTCAGCATGG + Intronic
1070428154 10:76309282-76309304 GCACCTTTGAAGCTTCAGTCAGG + Intronic
1070697976 10:78577153-78577175 ATTGCTTTGAGACTTCAGGCAGG + Intergenic
1074684698 10:115949765-115949787 GTTCCTGGGAGGCGGCAGCCAGG - Intergenic
1078452148 11:11448620-11448642 GTCCCTTTCCTGCTTCAGCCAGG - Intronic
1079742427 11:24079497-24079519 GTTCCTTTGAGGCTTGATCCTGG + Intergenic
1081487056 11:43538828-43538850 GTTTCGTTCAGGCTTCACCCCGG - Intergenic
1081705016 11:45177643-45177665 AGTCCTTTGAGGCTTGATCCTGG + Intronic
1081708200 11:45198903-45198925 ATTCCTTTGTGGCCTCAGGCAGG + Intronic
1083244499 11:61416070-61416092 GTTCCTTTCAGATTTGAGCCAGG - Intronic
1083851613 11:65370985-65371007 GCTCCTCTGAGGCATCGGCCTGG + Intergenic
1084023969 11:66436345-66436367 CATCCTTTGAGGCATCAGCCAGG + Intronic
1084330344 11:68426265-68426287 GATCCTGTGTGGCCTCAGCCAGG + Intronic
1084646855 11:70463892-70463914 GTTCCTTGGAGCCTTCACCGCGG - Intergenic
1085251102 11:75144572-75144594 TTTCCTCTGAGGCTTCAGTCAGG - Intronic
1091182064 11:133614252-133614274 GGTCATTTGTGGGTTCAGCCAGG - Intergenic
1091793023 12:3282248-3282270 GCTCCTTTGAGGATTCAGGAGGG + Intronic
1092714240 12:11371857-11371879 GTTCCTTTAAGGATTCGGGCTGG - Intronic
1093928360 12:24930867-24930889 GTTCCACTGAGGCTTCAGTGCGG - Intronic
1095811336 12:46375346-46375368 GTTCCTAACAGGCTTCAGACTGG - Intergenic
1097038941 12:56142834-56142856 GTCCCCTTGAGGCTCCAGCCGGG + Exonic
1102426404 12:112847685-112847707 TTTCCTTTCAGGCTCCAGGCAGG + Exonic
1102797366 12:115700474-115700496 TGTCCTTTGAGGCATCAGCAAGG + Intergenic
1104224520 12:126818851-126818873 GGTCCTTTGAGACTTCAGTCTGG - Intergenic
1105890860 13:24681247-24681269 GCTCCTTGGAGGCATCAGTCAGG + Intronic
1107806598 13:44159221-44159243 CTTCCTTTGAGCCTTCAGGGTGG - Intronic
1112317030 13:98372022-98372044 GTTGTTTTGAGGCTGCACCCAGG - Intronic
1116317923 14:43421498-43421520 CTTCCTTTGAAGCTACTGCCAGG + Intergenic
1117873527 14:60225462-60225484 GTTCCTTTGAGGCTTTAAGGAGG + Intergenic
1120623560 14:86796015-86796037 TTTCCTCTGAGGCTTCAGCGGGG - Intergenic
1121013694 14:90535825-90535847 GTTCCTGTGAGGCTCCCTCCTGG + Exonic
1123957873 15:25358283-25358305 GATGGTTTGAGTCTTCAGCCTGG + Intronic
1128237840 15:66079758-66079780 GTTCCTGTGATGCTGCTGCCAGG - Intronic
1128833113 15:70787183-70787205 GTTTCTTTGAGGCATTGGCCAGG + Intergenic
1131808066 15:96143722-96143744 GTTCCTTTTGGTCTGCAGCCAGG + Intergenic
1132567735 16:630996-631018 GTTCCTCTCCAGCTTCAGCCTGG - Exonic
1134690236 16:16186385-16186407 GTTCCTAAGAGGCTGCAGACTGG - Intronic
1137943167 16:52708784-52708806 CTCCCCTTGAGGATTCAGCCTGG - Intergenic
1138202843 16:55102835-55102857 GTTCTTCTGGGGCTTCATCCTGG + Intergenic
1141262184 16:82463928-82463950 GTTCCTGTGAGGCTGCTCCCTGG + Intergenic
1148479690 17:47951942-47951964 GTTCCTTTCAAGCTTCAGGAAGG - Intergenic
1148776791 17:50100381-50100403 GTGACTTTGAAGCTTCATCCTGG + Intronic
1149658068 17:58320557-58320579 GTTCCCTCTGGGCTTCAGCCTGG + Exonic
1150835276 17:68558174-68558196 TTTCCTTGCTGGCTTCAGCCGGG - Intronic
1150861124 17:68802142-68802164 GTTCATTTGAGAGTTAAGCCTGG - Intergenic
1152473262 17:80502045-80502067 TTTGCTTTAAGTCTTCAGCCAGG - Intergenic
1157148596 18:45191587-45191609 GTTTCTTGGGGACTTCAGCCAGG + Intergenic
1157990723 18:52492575-52492597 GTTCCTTTCACACTTCAGCAAGG - Intronic
1161681222 19:5680813-5680835 GTCACCTTCAGGCTTCAGCCAGG - Exonic
1161766822 19:6212987-6213009 GGTCCTGGGAGGCTGCAGCCAGG - Exonic
1162773707 19:12965853-12965875 GTTCCTTAGAGGCGTCAGGGCGG - Intronic
1163439504 19:17314570-17314592 GGACCTTGGGGGCTTCAGCCTGG + Intronic
1165112241 19:33509232-33509254 CTGCCTTTGGGGCTTCTGCCGGG - Intronic
1165225112 19:34349288-34349310 GCTCTTCAGAGGCTTCAGCCAGG - Intronic
1166787896 19:45380199-45380221 ACTCCTTTGAGGCTTCACCCTGG + Exonic
926140564 2:10365509-10365531 TTTTCTTGGAGGCTGCAGCCAGG + Intronic
934536328 2:95137214-95137236 GATCCTTTGAGGGTTCAGTTAGG - Intronic
937135613 2:119549674-119549696 TTTCCTATGAAGCTCCAGCCAGG + Intronic
937967444 2:127524980-127525002 GATCCTTTGAGCCCTGAGCCCGG - Intronic
938250576 2:129812820-129812842 CTTCCTGTGAGGCTGCACCCAGG - Intergenic
938549809 2:132369708-132369730 ACTCCTTTGAGTCTTCATCCAGG + Intergenic
940641084 2:156345035-156345057 ATTCCTTTGAAGCCTCAACCTGG - Intergenic
942304079 2:174589047-174589069 CTTCCCTTGAGGCCCCAGCCTGG - Intronic
943138703 2:183950360-183950382 TTTCCTTAGAGGCTCCAGCAGGG + Intergenic
943438755 2:187900165-187900187 GTTACTAGGAGGCTTCAGCCTGG + Intergenic
944775877 2:202963943-202963965 GTTCCTATCAGGCTACAGACTGG + Intronic
946187001 2:217986676-217986698 GTTCTTGTCAGGCTTCAGCAGGG - Intronic
948174403 2:235931792-235931814 CTTCCTTTAAGGCTTCTGCTTGG - Intronic
948666412 2:239537293-239537315 CTTCCTTTGCTGCTGCAGCCTGG - Intergenic
1172099438 20:32476349-32476371 GTTCCTTGGAGCCTTGAGCAAGG + Intronic
1172869569 20:38127339-38127361 GTTCCTTGGACGCTACAACCTGG - Intronic
1177817777 21:25996899-25996921 GTTGCTTTGAGGCAGGAGCCTGG + Intronic
1178435069 21:32551026-32551048 ATTTCTTTCAGGCTTCATCCAGG - Intergenic
1179408021 21:41141272-41141294 TTTCCCTTATGGCTTCAGCCTGG + Intergenic
1180001505 21:44997421-44997443 GTGGCCTTGAGGCCTCAGCCTGG - Intergenic
1181957455 22:26598468-26598490 GATCACTTGAGGCTTTAGCCTGG - Intergenic
1182369090 22:29798446-29798468 CTTCCTTTGAGGCTGCAGAGGGG - Intronic
1182528328 22:30935621-30935643 TTTCCTTTCTGGCTTCATCCAGG - Intronic
1182855501 22:33514015-33514037 GTTGCTTCTAGGCTACAGCCTGG - Intronic
1183611217 22:38907666-38907688 GTCTCTTTGAGGCTTTAGCCTGG + Intergenic
950508158 3:13408976-13408998 GTGCCTTTGAGGAGGCAGCCTGG - Intronic
952016029 3:28958774-28958796 GCTCCGTGGAGTCTTCAGCCTGG - Intergenic
954916866 3:54156012-54156034 GTTTTTTTGAGGCTTTAGCCTGG + Intronic
955697199 3:61648596-61648618 GTTCCCTTGGTGCATCAGCCTGG - Intronic
958080895 3:88744810-88744832 GTGACTTTGAGTCTTCAGCATGG - Intergenic
961449738 3:126997260-126997282 ATTTCTTTGGGGTTTCAGCCTGG + Intronic
963159977 3:142141094-142141116 GGACCTGTGAGGCTGCAGCCGGG - Intronic
964835223 3:160930632-160930654 GTTCCTTTGAGGCTTCAGCCTGG - Intronic
972136231 4:35897815-35897837 CCTCCTTTGAGGCTGCAACCTGG - Intergenic
975372361 4:73603520-73603542 GTTCCTTTAAGGCTCCAGCTTGG + Intronic
979844598 4:125491479-125491501 GTACCTTCGAGGCTTCAGTCTGG - Exonic
986602629 5:9488302-9488324 GTTCCTCTGAGACTTCATCTGGG - Intronic
988441670 5:31241018-31241040 GTTTCCTTGGGGCTGCAGCCTGG - Intronic
989735860 5:44704890-44704912 GTTACTTTGAGGCAACAGCTTGG - Intergenic
991066742 5:62432071-62432093 GTTCCTTTGAGGCTTGAGCTGGG + Intronic
998648213 5:144088364-144088386 GTTCCTTTGAGCCAGGAGCCAGG + Intergenic
1000240341 5:159403015-159403037 GTTCCTTTGATTCTTCTGCTTGG + Intergenic
1007296207 6:40823281-40823303 GTTACTTTGATGCCTGAGCCTGG - Intergenic
1010722625 6:79301035-79301057 CTACCTTTGAGGCTTCAGGTTGG + Intergenic
1013415907 6:109924355-109924377 GTTCTTTTTAGGCAGCAGCCTGG - Intergenic
1017506664 6:155074815-155074837 GAACCTCTGAGGATTCAGCCTGG + Intronic
1021012704 7:15491628-15491650 TTTCCTTTGGGGCTTCATCTTGG - Intronic
1021756007 7:23853376-23853398 GTTCCTCTGAGGCTTGAGCTTGG + Intergenic
1021843845 7:24745211-24745233 GTCCCTTTCAGTCTTCACCCTGG - Intronic
1024237661 7:47410097-47410119 TTTCCTAGGAGGCTTCACCCTGG - Intronic
1025039054 7:55623833-55623855 GTGCTTTTGTGACTTCAGCCAGG + Intergenic
1026489012 7:70846575-70846597 GTTCCTCGGAGACTTCAGTCTGG + Intergenic
1031508302 7:122615182-122615204 GTGGCCTTGAGGCTTCGGCCTGG + Exonic
1032035188 7:128516521-128516543 GTTCCTTGGCAACTTCAGCCTGG + Intergenic
1033213778 7:139479830-139479852 CTTCATTTGAGGCAGCAGCCAGG - Intronic
1033427242 7:141255297-141255319 GTTCCTTTAAGGCTAGAGTCTGG - Intronic
1034186135 7:149178817-149178839 GTCCCTCAGAGGCTTCAGGCAGG - Exonic
1036567402 8:9949215-9949237 GAACCTTTGAGGCTACAGCAAGG - Intergenic
1036806745 8:11840142-11840164 GTTCATTTGAGGCTTAGCCCTGG + Intergenic
1038241139 8:25808888-25808910 GTTCCTTTGAGGGTCCCACCTGG + Intergenic
1038451067 8:27639309-27639331 GTTCTTTTGTGGCATCTGCCTGG - Intronic
1045055415 8:98364166-98364188 TTTCCTATGAGGCCTCAGGCTGG + Intergenic
1055216200 9:73865865-73865887 TTTGCTTTGAAGCATCAGCCTGG + Intergenic
1055931729 9:81566128-81566150 TTACCTTTGAGGCTGCTGCCTGG + Intergenic
1056931235 9:90879874-90879896 GTTCATTTGAGGGTTCAGAGAGG - Intronic
1059465515 9:114466737-114466759 GTTCACCTGAGGCTTCAGTCGGG + Intronic
1059487494 9:114637926-114637948 GTTCCTGTGTGGCCTCAGGCAGG + Intronic
1061740429 9:132700102-132700124 GTTTCTTTTTGGCTTCAGCATGG - Intergenic
1062227945 9:135464413-135464435 GTTCCTTAGAGCCTTGAGCCTGG + Intergenic
1186078639 X:5907269-5907291 CTTCCTTTTAGGCCACAGCCAGG + Intronic
1186655225 X:11605030-11605052 GATGCTGTGAGGCTTCATCCAGG - Intronic
1191840711 X:65511940-65511962 ATTCCTTAGAGCCTTCAGCCTGG - Intergenic
1194652451 X:96532530-96532552 GTTTCTTTGAGGCTTGAGCCTGG - Intergenic
1200051649 X:153435139-153435161 GTTCCTCTGAGGCTTGAGCCTGG + Intergenic