ID: 964835224

View in Genome Browser
Species Human (GRCh38)
Location 3:160930643-160930665
Sequence ATTTTGAGATGGTTCCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 399}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964835224_964835232 20 Left 964835224 3:160930643-160930665 CCTCAAAGGAACCATCTCAAAAT 0: 1
1: 0
2: 4
3: 49
4: 399
Right 964835232 3:160930686-160930708 TTAAGAGGGAAGCTTCGTATGGG 0: 1
1: 0
2: 0
3: 3
4: 73
964835224_964835229 5 Left 964835224 3:160930643-160930665 CCTCAAAGGAACCATCTCAAAAT 0: 1
1: 0
2: 4
3: 49
4: 399
Right 964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG 0: 1
1: 1
2: 0
3: 7
4: 108
964835224_964835230 6 Left 964835224 3:160930643-160930665 CCTCAAAGGAACCATCTCAAAAT 0: 1
1: 0
2: 4
3: 49
4: 399
Right 964835230 3:160930672-160930694 CGGAGTGAAGGAGTTTAAGAGGG 0: 1
1: 3
2: 9
3: 18
4: 177
964835224_964835231 19 Left 964835224 3:160930643-160930665 CCTCAAAGGAACCATCTCAAAAT 0: 1
1: 0
2: 4
3: 49
4: 399
Right 964835231 3:160930685-160930707 TTTAAGAGGGAAGCTTCGTATGG 0: 1
1: 0
2: 0
3: 7
4: 101
964835224_964835228 -6 Left 964835224 3:160930643-160930665 CCTCAAAGGAACCATCTCAAAAT 0: 1
1: 0
2: 4
3: 49
4: 399
Right 964835228 3:160930660-160930682 CAAAATTTTAGGCGGAGTGAAGG 0: 1
1: 0
2: 2
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964835224 Original CRISPR ATTTTGAGATGGTTCCTTTG AGG (reversed) Intronic
903019043 1:20380862-20380884 ATTTTGAGCTGTTTCCTGAGCGG - Intergenic
905364185 1:37439861-37439883 ATTTGGAGATGGGGCCTTTGGGG - Intergenic
905850907 1:41274127-41274149 ATTTTGATATGGTACCATTGGGG - Intergenic
906259319 1:44374521-44374543 ATTTGGAGGTGGGGCCTTTGGGG + Intergenic
907537881 1:55181838-55181860 ATTTGGAGATAGTGCCTTTAAGG + Intronic
907812725 1:57888135-57888157 AATTTGAAATGTTTTCTTTGAGG + Intronic
908126986 1:61042072-61042094 CATTTCAGATGGTTGCTTTGAGG + Intronic
908895219 1:68890956-68890978 ATTTTGAAATTTTTCTTTTGTGG - Intergenic
909525878 1:76622172-76622194 TTCATGAAATGGTTCCTTTGGGG - Intronic
911441190 1:97927592-97927614 ATTATGAGGTGGGCCCTTTGAGG - Intergenic
912069398 1:105789856-105789878 TTTTGAAGCTGGTTCCTTTGGGG - Intergenic
912187664 1:107298790-107298812 ATGCTGAAATGGTTCATTTGAGG - Intronic
913921104 1:124833502-124833524 ACTTTGTGATGATTCCTTTCAGG + Intergenic
914760320 1:150593383-150593405 ATTTTTCGATGGATCTTTTGGGG + Intergenic
915281440 1:154825116-154825138 AAATTGATATGGTTCCTTGGGGG + Intronic
915461912 1:156075566-156075588 AATTTGAGATGTTTCTTTGGAGG + Exonic
917269337 1:173256477-173256499 ATTTTGAGATGGGACTTTTAGGG - Intergenic
917542897 1:175932862-175932884 ATTTTGAGATGGTTTTTCAGAGG + Intergenic
917797076 1:178540244-178540266 ATTTGGAAATGGTTCCCCTGAGG - Intronic
918722526 1:187871554-187871576 AATTTGAAATGGTTCCTTTATGG + Intergenic
919144930 1:193621834-193621856 CTTTTGAGACAGTTCCTTTTTGG + Intergenic
920040795 1:203094739-203094761 ATTTAGAGATGGAGCCTTTGGGG - Intronic
922926544 1:229351615-229351637 ATTTGGAGATGGGGCCTGTGAGG - Intergenic
923026588 1:230209297-230209319 ATTTGGAGACAGGTCCTTTGTGG + Intronic
923292490 1:232560078-232560100 GTTCTGAGTTAGTTCCTTTGTGG - Intronic
923599687 1:235391463-235391485 TTTTTGAGATGGAGTCTTTGTGG - Intronic
923982603 1:239342019-239342041 AGTTTGAGATGATTTCTTGGAGG - Intergenic
924462360 1:244270699-244270721 ATTTGGAGGTGGGGCCTTTGGGG + Intergenic
924907970 1:248476874-248476896 ATATTTGGATGGTTCCTTTTTGG + Intergenic
924916139 1:248571209-248571231 ATATTTGGATGGTTCCTTTTTGG - Intergenic
924954768 1:248915745-248915767 ATTTTCAGATAGCTCCCTTGCGG - Intronic
1063591625 10:7400817-7400839 TTTTTGAGATGTTTGCTCTGTGG - Intronic
1063801116 10:9579284-9579306 ATTAAGAGATGGGGCCTTTGGGG - Intergenic
1063863384 10:10337325-10337347 TTATTGAGTTGTTTCCTTTGGGG + Intergenic
1064792090 10:18969300-18969322 ATTTTTATTTTGTTCCTTTGGGG + Intergenic
1065776666 10:29126629-29126651 ATTTTGACAAGGTTCCCTGGTGG + Intergenic
1066788907 10:39041363-39041385 ATTTTGTGAGTGTTCATTTGGGG + Intergenic
1067171828 10:43913040-43913062 ATTTGGAGATGAGGCCTTTGGGG + Intergenic
1068087481 10:52392527-52392549 ATTCTGAGTTGGTTGCTTTAAGG - Intergenic
1068268605 10:54688742-54688764 ATTTTGAGATGCTGCTTTTGGGG - Intronic
1068514053 10:58004336-58004358 ATTTTGTGATTTTACCTTTGAGG - Intergenic
1069195690 10:65548327-65548349 ATCAAGAGATGGGTCCTTTGGGG + Intergenic
1069361502 10:67647992-67648014 ATTTAGAGATTGTTTATTTGAGG + Intronic
1069696495 10:70389502-70389524 ATTCTGAGATGGTTCATTCTGGG - Intergenic
1070005709 10:72422099-72422121 ATTTGGAGATGGGGCCTTAGAGG + Intronic
1070420867 10:76235937-76235959 ATTTCGAGCTGGTTACTCTGAGG - Intronic
1071215004 10:83391093-83391115 ATTTTGAAATAGTTTCTTTCTGG - Intergenic
1071413009 10:85415137-85415159 ATTTAGAGATGGGGCCTCTGAGG - Intergenic
1072338282 10:94420088-94420110 ATTTGGAGGTGGTATCTTTGAGG + Intronic
1072639024 10:97196816-97196838 ATATTGAGATGAAGCCTTTGTGG + Intronic
1074107050 10:110396242-110396264 ATTTTAAGGAGGCTCCTTTGTGG + Intergenic
1074998032 10:118774502-118774524 TCTTTGAGATATTTCCTTTGGGG + Intergenic
1076016164 10:127028961-127028983 ATTTTGAGACGAGTCCTCTGTGG - Intronic
1076486481 10:130822533-130822555 ATTTTGGGATAGGTCCTTTCAGG - Intergenic
1076854446 10:133109013-133109035 AAGTGGAGCTGGTTCCTTTGTGG - Intronic
1077295129 11:1822966-1822988 ATTTGGAGATGCTGCCTTTCCGG + Intergenic
1078464084 11:11537676-11537698 ATCCTGAGATGGTTCTGTTGTGG - Intronic
1078828916 11:14960223-14960245 ATTTGGAGATAGGGCCTTTGAGG - Intronic
1079570711 11:21940417-21940439 ATTTGGAGATGGGGCCTTTAGGG + Intergenic
1079724830 11:23867798-23867820 ATTTTGAAATGGTTGCTATAGGG - Intergenic
1079742426 11:24079486-24079508 TTTTTCTCATGGTTCCTTTGAGG + Intergenic
1080275496 11:30499079-30499101 ATTTTGTGATGGCTGCTTTGGGG - Intronic
1083527890 11:63387936-63387958 TTTTTTAGATGGTTCCTTATTGG + Intronic
1084600542 11:70142934-70142956 ATTTGAAGATGGGGCCTTTGGGG - Intronic
1084691688 11:70731075-70731097 ATTTGGAGATGGGACCTTTAAGG + Intronic
1085984187 11:81765267-81765289 ATTTGGAGATAGGGCCTTTGAGG - Intergenic
1086106202 11:83150213-83150235 TTTTTTAAATGGTTGCTTTGTGG + Intergenic
1086535248 11:87836534-87836556 ATTTTGTGGTGGTAACTTTGGGG - Intergenic
1087494951 11:98879662-98879684 ATTAAGAGATGGTGCCTTTAGGG - Intergenic
1088434327 11:109794388-109794410 ATTAAGAGATGGTGCCTTTGGGG - Intergenic
1088485128 11:110333320-110333342 ATTTTTAGATAGTTGCTGTGGGG - Intergenic
1088866151 11:113849942-113849964 ATTTTTAAATGGTTCTATTGTGG - Intronic
1090200940 11:124855699-124855721 ATTTGGAGATGTGGCCTTTGGGG - Intergenic
1090601709 11:128379159-128379181 ATTTGGAGATGGGGCCTTTAAGG - Intergenic
1090723878 11:129503997-129504019 ATTTTAAGCAGGTTCCTTAGTGG + Intergenic
1091360315 11:134974141-134974163 ATCTGGAGATGGGTCCTTTGTGG - Intergenic
1091502484 12:1032387-1032409 AATTTGTGATGGTTCTGTTGTGG + Intronic
1092361305 12:7838829-7838851 ATTTGGAGATGGAGCCTTTAAGG + Intronic
1092375746 12:7954093-7954115 ATTTGGAGATGGGGCCTTTAAGG + Intergenic
1093392735 12:18642138-18642160 TTTTATAGATGGTACCTTTGGGG + Intronic
1093645011 12:21575754-21575776 ATTTTGAGATGATGCCATTATGG - Intronic
1094062235 12:26326568-26326590 ATTAGGAGAAGGGTCCTTTGAGG - Intergenic
1094233712 12:28138700-28138722 ATTATGAGGTAGTGCCTTTGAGG - Intronic
1094367143 12:29695624-29695646 ATTTGGATATGGATCTTTTGGGG + Intronic
1095654287 12:44650640-44650662 ATTTAGAGATGGGGCCTTTCAGG + Intronic
1098334823 12:69392457-69392479 ATTTTGAATTGTTTCCTTTTTGG - Intergenic
1098823906 12:75269436-75269458 ATTGTGAGATGGCCCTTTTGAGG - Intergenic
1099870345 12:88340495-88340517 AATTTGTGATAGTTTCTTTGCGG + Intergenic
1099877983 12:88432871-88432893 ATTTTGAGTTTCTGCCTTTGGGG - Intergenic
1099891026 12:88588509-88588531 AGTTTGAAATGGTTTCTTTAAGG - Intergenic
1100041348 12:90321863-90321885 ATTTTGAGATGGCTATTTAGAGG - Intergenic
1100078407 12:90817451-90817473 AATTGGAGATGGTTCCAGTGTGG - Intergenic
1100153483 12:91769927-91769949 ATTTGGAAATAGGTCCTTTGTGG - Intergenic
1101074864 12:101118435-101118457 ATTTTAAAATGTTTTCTTTGGGG - Intronic
1101861369 12:108485086-108485108 ATTTGGAGATGGGGCCTTTAAGG + Intergenic
1102981822 12:117247650-117247672 ATTTTGAGATAGGGCCTTTAAGG + Intronic
1104236383 12:126941854-126941876 ATTAAGAGATGGGGCCTTTGGGG - Intergenic
1106110627 13:26773450-26773472 ATTTGGAGATAGGTCCTTTATGG - Intergenic
1106985217 13:35339356-35339378 ATTTTCAGATGGTTCATTGCTGG - Intronic
1107121188 13:36797837-36797859 ATTAGGAGGTGGGTCCTTTGGGG - Intergenic
1107221775 13:37989844-37989866 ATTTTGTGCTGGTTAGTTTGAGG - Intergenic
1107230067 13:38097933-38097955 ATTTTAAGAGGGGTCCTTTGAGG - Intergenic
1108009470 13:45989928-45989950 CTCTTGAGATGATTGCTTTGAGG - Intronic
1109240995 13:59888150-59888172 ATTATGACATGGGGCCTTTGGGG + Intronic
1109329750 13:60914286-60914308 ATTTTGAAATGTTGACTTTGAGG - Intergenic
1109804026 13:67414041-67414063 ATTAGGAGATGGGGCCTTTGGGG - Intergenic
1110285745 13:73748403-73748425 ATCTGGAGATGGGGCCTTTGGGG + Intronic
1110687840 13:78396133-78396155 ATTTGGAGGTGGGGCCTTTGGGG + Intergenic
1111154598 13:84306364-84306386 ATGGTGTGGTGGTTCCTTTGGGG - Intergenic
1111846454 13:93514992-93515014 ATTTAGAGAGGGGGCCTTTGTGG + Intronic
1113084273 13:106551592-106551614 ATTTTGAGCTGTTTAGTTTGTGG - Intronic
1114227845 14:20755043-20755065 AGTTTGAAATGGTTCCTTTAAGG + Intergenic
1114229105 14:20764381-20764403 AGTTTGAAATGGTTCCTTTAAGG + Intergenic
1114324759 14:21577471-21577493 ATTTTGATTTGGTTCCTTGTGGG - Intergenic
1115155129 14:30330104-30330126 ATTTTGATATGGTTCCTACATGG - Intergenic
1115574974 14:34702503-34702525 ATTTTGAGATGGAGCCTTGCTGG - Intergenic
1117138596 14:52763705-52763727 ATTTTTTGATGTTTTCTTTGTGG + Intronic
1117580972 14:57151369-57151391 ATTTTGAGATAGGACCTATGAGG + Intergenic
1117589699 14:57254670-57254692 ATTTGGAGATGGGACCTTTGGGG + Intronic
1117964640 14:61194351-61194373 ATTTGGAGATGGGACTTTTGGGG + Intronic
1118057659 14:62098430-62098452 ATTTTATGATGGTTCCATTCAGG + Intronic
1118491911 14:66269336-66269358 ATTTTTAGATCGTTTCTTTTGGG - Intergenic
1118495881 14:66307833-66307855 ATTTGGAGATGGGACCTTTAAGG - Intergenic
1118756972 14:68851956-68851978 ATTTGGAGATGGGGCCTTTGGGG + Intergenic
1118943101 14:70356601-70356623 TTTTTATGATGTTTCCTTTGAGG - Intronic
1119633828 14:76257762-76257784 ATTTGGAGATAGGTCCTTTAAGG - Intergenic
1120126560 14:80750878-80750900 ATTTGGAGATGGGGCCTTTAGGG + Intronic
1120429879 14:84400386-84400408 ATTTTAAGACAGTTCTTTTGGGG + Intergenic
1120577772 14:86205299-86205321 ACTTTGTTATGGTTCCCTTGAGG + Intergenic
1121028256 14:90633204-90633226 ATCTTGAGAGGTTTGCTTTGTGG + Intronic
1121214183 14:92234464-92234486 ATTTGGAGATGGGGCCTTTAAGG + Intergenic
1122569125 14:102682611-102682633 CTTTTCAGATGGTTTTTTTGGGG + Intronic
1123773506 15:23553909-23553931 ATTTAGAGGTGGCACCTTTGTGG + Intergenic
1124006328 15:25798203-25798225 GTTTTGATATTGTTGCTTTGGGG - Intronic
1126204120 15:46023383-46023405 ATCTTAAAATAGTTCCTTTGTGG - Intergenic
1126522872 15:49616187-49616209 ATTTGCAGATGGAGCCTTTGAGG + Intronic
1126789329 15:52206446-52206468 ATTTGGAGATGGGGCCTTTAGGG + Intronic
1128483115 15:68056334-68056356 ATTTTAAGAAAGTGCCTTTGGGG + Intronic
1128694488 15:69750350-69750372 ATTTTAAGTTGCTACCTTTGTGG - Intergenic
1129067920 15:72923573-72923595 AATTTGAAATGGTTCCATTAAGG + Intergenic
1129643955 15:77413183-77413205 ATTTTGAGAGAGCTACTTTGAGG - Intronic
1129664966 15:77574459-77574481 ACTGTGAGTTGGTTCCCTTGGGG - Intergenic
1130318325 15:82816152-82816174 ATTTGAAGATGGGGCCTTTGGGG - Intronic
1131218090 15:90557314-90557336 ATTTTGAGCTGTTCCCCTTGAGG + Intronic
1131408722 15:92188039-92188061 ATTTTGTGTTGGTTGCCTTGGGG + Intergenic
1131580192 15:93635468-93635490 ATTCTAAGATGGGCCCTTTGGGG + Intergenic
1133866568 16:9649676-9649698 ATATTGAGATGTTTTATTTGGGG - Intergenic
1135352961 16:21745404-21745426 ACTGTGACATGATTCCTTTGAGG + Intronic
1135451447 16:22561527-22561549 ACTGTGACATGATTCCTTTGAGG + Intergenic
1135516969 16:23144252-23144274 ATCTTGAGATAGTTACCTTGAGG - Intronic
1135906850 16:26519916-26519938 ATTTGGAGATGGAGCCTTTTGGG + Intergenic
1138671358 16:58617694-58617716 ATTTTGAGGTGTTTACATTGAGG - Intronic
1138861319 16:60761749-60761771 ATTTAGATATGGCTCCTATGTGG + Intergenic
1139442077 16:66973433-66973455 ATTTTGAGAGAGCTCCTCTGAGG - Exonic
1140838135 16:78814592-78814614 ATTTCAAGATGTATCCTTTGTGG + Intronic
1141555617 16:84834911-84834933 ATTTGGAGACGGGGCCTTTGCGG - Intronic
1141741354 16:85895291-85895313 ATTTGGAGATGGGACCTTCGTGG - Intergenic
1145086111 17:19942296-19942318 ATTTTATGTTTGTTCCTTTGTGG - Intronic
1145283532 17:21486617-21486639 ATTTTGAGATGGCTGTTTAGAGG + Intergenic
1145393924 17:22478883-22478905 ATTTTGAGATGGCTCTTTAGAGG - Intergenic
1145859041 17:28191729-28191751 AGTTTCAGGTGGTTACTTTGGGG - Intronic
1146432232 17:32808623-32808645 ATTTGGAGAGGGGGCCTTTGGGG + Intronic
1149225671 17:54467425-54467447 ATCTTGAGATGGTTAATTTTAGG + Intergenic
1149930497 17:60749619-60749641 TTTTTGAGATAGTTCCAGTGTGG + Intronic
1150017494 17:61573045-61573067 ATTTTGAGATGCTCCTCTTGGGG + Intergenic
1150709951 17:67522549-67522571 ATTGTTAGATGGTTTCCTTGAGG + Intronic
1151146824 17:72049002-72049024 AATTTGAGGTGGGGCCTTTGAGG + Intergenic
1152040765 17:77901153-77901175 ATTTGGAGATGGGGCTTTTGGGG + Intergenic
1152792299 17:82287861-82287883 ATTTGGAGATGGAGCCTTTGAGG + Intergenic
1153036187 18:764598-764620 AGTTTCAGATGGTTCGTTTTAGG + Intronic
1154989574 18:21588082-21588104 TTTTTGAGATGGATCCTTGCTGG - Intronic
1155846311 18:30712052-30712074 ATTTTGATGTGGTACCTTTTTGG + Intergenic
1156461589 18:37324278-37324300 ATTTGGAAATGGTACCTTTAAGG + Intronic
1156747834 18:40414062-40414084 ATTCTCAGATGGTTTCTTTGTGG - Intergenic
1156850227 18:41717598-41717620 AATTTTAGCTGCTTCCTTTGGGG - Intergenic
1157049404 18:44144249-44144271 ATTTTGAGAAGGTTTTTATGAGG - Intergenic
1157302927 18:46492632-46492654 AATTTCAGATGGTTCCTTCTTGG - Intronic
1158012263 18:52742280-52742302 ATTTGGAGAAGGTTTCATTGAGG - Intronic
1158864363 18:61623824-61623846 ATATTTAGAATGTTCCTTTGGGG - Intergenic
1159296376 18:66494711-66494733 ATTTTAGGATGGTTCTTATGTGG - Intergenic
1159554101 18:69927065-69927087 ATTAAGAGATGGTGCTTTTGGGG + Intronic
1160542005 18:79628988-79629010 TTTCTGTGATGGTTCCGTTGTGG - Intergenic
1161142029 19:2653763-2653785 ATCTTCAGATGGTGCCCTTGAGG + Intronic
1165712678 19:38023342-38023364 ATTTAGCGCTGGTTCTTTTGCGG - Intronic
1166920405 19:46225357-46225379 ATTTGGAGATGTTCCCTTTAGGG - Intergenic
1167734977 19:51288654-51288676 ATTTGGAGCTGGGGCCTTTGGGG - Intergenic
1168038122 19:53736697-53736719 AACTGGAGATGGTTCCTTTAGGG + Intergenic
1168368610 19:55812051-55812073 GTTTTGATATGCTTCCATTGTGG - Intronic
925764154 2:7214763-7214785 ATTTTAAGTTGGTTACTTTAAGG + Intergenic
926147073 2:10403018-10403040 ATTTGGAAATAGTTCCTTTGGGG + Intronic
926165556 2:10520758-10520780 GTTTGGAGATGGGGCCTTTGGGG - Intergenic
927189109 2:20504509-20504531 ATTTGGAGATGGGGCCTTTGGGG - Intergenic
927196015 2:20547313-20547335 ATTTGGAGATGGGGCCTTTGAGG + Intergenic
928702066 2:33909122-33909144 ATTTTGAGATAAGTCCTTTAAGG - Intergenic
929607494 2:43244671-43244693 ATTTGGTGACGATTCCTTTGGGG + Intronic
929939855 2:46325276-46325298 TTTTTTAGATAGTTCCTTTTGGG + Intronic
930117692 2:47732589-47732611 ATTTTGAAATGGTTGCTTCAGGG + Intronic
930118240 2:47738425-47738447 ATTTTGAGATGGCTATTCTGAGG + Intronic
930181562 2:48364404-48364426 ATTTTGATATAATTCCTTTGGGG + Intronic
931484410 2:62675780-62675802 ATTTTGAGATGGGTCCTGACGGG + Intronic
933855091 2:86405202-86405224 ATTTTGAGTTATTTCCTTAGTGG - Intergenic
935241184 2:101179473-101179495 ATTTGGAGATAGGGCCTTTGAGG - Intronic
935463672 2:103368900-103368922 ATTTGGAGGTGGCTCCTTTGGGG - Intergenic
935537169 2:104308206-104308228 ATTAGGAGATGGGGCCTTTGTGG - Intergenic
937527312 2:122787272-122787294 ATTTTGAGATGGGACCTCTAAGG + Intergenic
937918209 2:127110276-127110298 ATTTTAAAATGCTTGCTTTGAGG + Intergenic
938903061 2:135814920-135814942 ATTTGGAGATAGGGCCTTTGAGG + Intronic
939667725 2:144970870-144970892 ATTATGAGATGGGTCCTCAGAGG + Intergenic
939928846 2:148207049-148207071 AATTTGAAATGGTTTCTTTAAGG - Intronic
940582202 2:155596782-155596804 ATTTTCAAATTGTTCATTTGTGG - Intergenic
941269618 2:163408958-163408980 ACTTTGTGATGGTTACTTTTGGG - Intergenic
943647208 2:190418971-190418993 ATTGTGACATGGTTCCTTTATGG - Intronic
944038464 2:195326669-195326691 TTTTTAAGAGGTTTCCTTTGAGG - Intergenic
944589838 2:201206810-201206832 TTTTTCAGATGGTTCATTTCTGG - Intronic
944737367 2:202579633-202579655 ATTTTGAGGTAGTTTGTTTGAGG + Intergenic
945065042 2:205941215-205941237 ATTTGGAGATGGGGCCTTTGGGG - Intergenic
945100875 2:206261222-206261244 AGTTTGAGAGGGGTCCCTTGTGG + Intergenic
945200333 2:207274894-207274916 AATTTGAGATGGTTTGTCTGTGG - Intergenic
946858672 2:223978851-223978873 ATTTGGAGATAATGCCTTTGAGG + Intronic
947129022 2:226902722-226902744 TTTTTGAGATGGAACTTTTGTGG + Intronic
947943951 2:234083650-234083672 ATTTGGAGATGAAGCCTTTGGGG - Intergenic
948787588 2:240360434-240360456 AGATTGAGATCTTTCCTTTGAGG - Intergenic
948966842 2:241388912-241388934 ATTTGGAGATAGGACCTTTGGGG + Intronic
1169054072 20:2605580-2605602 ATTTGGAGATGGGGCCTTTAAGG - Intronic
1169386581 20:5155144-5155166 ATTTTATGGTGGTTCCTTGGAGG + Intronic
1169866841 20:10210415-10210437 ATTTAAAGATGGTTACTTTTGGG - Intergenic
1170486594 20:16822949-16822971 ATTGTTAGATGGTTGCTTTATGG - Intergenic
1170606365 20:17877919-17877941 ATTTGGAGATGGATGCTCTGTGG + Intergenic
1170671666 20:18439938-18439960 ATTTGGAGATAGGTCCTTTAAGG + Intronic
1173677970 20:44854383-44854405 AATTGGAGATGGTGTCTTTGGGG + Intergenic
1174021536 20:47534089-47534111 ATTTTGTGATGGTTTCAGTGGGG + Intronic
1174086506 20:48012281-48012303 ATTTTGAGTTAGTTACTGTGTGG + Intergenic
1174497058 20:50954289-50954311 ATTGTGAGATATTTCCTTAGGGG - Intronic
1174871541 20:54187136-54187158 GTTTTGAGAAGGTTAATTTGTGG + Intergenic
1177310618 21:19387450-19387472 ATTTAGACATGGTTCCTTTTAGG + Intergenic
1177406835 21:20680000-20680022 AGTTTGAGAAGGTTCCTCTTAGG + Intergenic
1177817775 21:25996888-25996910 AATTTGAGATGGTTGCTTTGAGG + Intronic
1177870510 21:26567102-26567124 ATTTTGAAATTATTCCTTTTTGG - Intronic
1178232083 21:30797366-30797388 ATTTAAAGATGGTTTCTTGGTGG + Intergenic
1178292523 21:31381240-31381262 ATTTGGAGGTGGGGCCTTTGCGG + Intronic
1179359108 21:40689025-40689047 ATATTGTCATGGTTCCTTTTGGG - Intronic
1179954691 21:44732028-44732050 ATTAGGAGATGGGTCCTTTGGGG - Intergenic
1180012732 21:45061973-45061995 TTTTTGTGATGGTTCATTTTAGG + Intergenic
1181138145 22:20783925-20783947 GTTATGAGAAGGTTCCTTTAGGG - Intronic
1181486665 22:23235913-23235935 ATTTAGAGGTGGGGCCTTTGGGG - Intronic
1182847683 22:33445207-33445229 ATTTTGAGATGGGACCTTGAAGG - Intronic
1184574133 22:45348488-45348510 ATTTAGAGATGGTACTCTTGGGG + Intronic
1185092710 22:48784986-48785008 ATTTGGAGATGGGGCCTGTGAGG + Intronic
949115619 3:318008-318030 ATTTTAAGATGGGTCAGTTGAGG + Intronic
949525009 3:4894842-4894864 ATTTTGAGTTGGGTCTCTTGGGG + Intergenic
949952130 3:9238108-9238130 ATTTTGGGCTGGATCATTTGTGG - Intronic
951326762 3:21312309-21312331 ATTTTGAGCTAGGTCCTTTAAGG - Intergenic
951635510 3:24770626-24770648 ATTTAGAGATTGATCTTTTGTGG - Intergenic
951735885 3:25863306-25863328 ATTTTGAGATGGTTATTCAGAGG + Exonic
952333742 3:32387264-32387286 ATTTGGAGATGGACTCTTTGGGG + Intergenic
952679894 3:36079318-36079340 ATTTGGAGATGGGGTCTTTGGGG - Intergenic
953110367 3:39931669-39931691 AGGTTGAGAAAGTTCCTTTGTGG + Intronic
953364559 3:42332096-42332118 ATTTTGAAATGTGACCTTTGGGG + Intergenic
953577282 3:44123111-44123133 ATTTGGAGATGGGACCTTTAAGG + Intergenic
955997338 3:64690549-64690571 ATTTTTGGAGGGTTGCTTTGTGG + Intergenic
956099276 3:65750189-65750211 ATTATAGGATGGTTGCTTTGGGG - Intronic
956368515 3:68532567-68532589 ATTTTGAGATGGCTACTCAGAGG - Intronic
957572492 3:81965534-81965556 TTTCTGAAATGGTTCCTTGGAGG - Intergenic
957764676 3:84607642-84607664 ATTCTGTGAAGATTCCTTTGTGG + Intergenic
959111691 3:102130467-102130489 ATCTTGAGTTGGTTCCTTGTTGG + Intronic
959518409 3:107297768-107297790 ATTAAGAGATGGAGCCTTTGGGG + Intergenic
960066847 3:113383448-113383470 ATTTGGAGGTGGGGCCTTTGAGG - Intronic
961000270 3:123369465-123369487 ATTTGGAGATGGTTTCTATCAGG + Intronic
961384050 3:126514611-126514633 TTTTTCAGATTGTTCCTTCGTGG - Intronic
962400340 3:135053530-135053552 ATTTTGAGATGAGGTCTTTGAGG + Intronic
962948691 3:140198255-140198277 ATGTTGTGTTGGTGCCTTTGGGG + Intronic
963071641 3:141309777-141309799 ATTAAGAGATGGGACCTTTGGGG + Intergenic
963912119 3:150823784-150823806 AAGTTGAGATAGTTCCTTTGAGG - Intergenic
964458691 3:156897241-156897263 ATTCGGAGATGGGGCCTTTGTGG + Intronic
964835224 3:160930643-160930665 ATTTTGAGATGGTTCCTTTGAGG - Intronic
964885182 3:161473884-161473906 ATTTTGAGTTGGTTACTTTGAGG - Intergenic
964990632 3:162807052-162807074 AGTTTAAGATGGGTCCTTTATGG - Intergenic
965156882 3:165071619-165071641 ATTTGGAGATAGGTCCTTTAAGG + Intronic
965441359 3:168719188-168719210 ATTTTGAGATGGGAACTTTTAGG + Intergenic
966668471 3:182499710-182499732 AATTAGAGTTGGTTCCTTTTTGG - Intergenic
967350179 3:188506283-188506305 ATTTTTAGAAGGTTATTTTGAGG + Intronic
967727218 3:192873017-192873039 ATTTTGAGTTGCTTGCTTGGTGG - Intronic
968893044 4:3382079-3382101 CTTTGGATATTGTTCCTTTGTGG + Intronic
969050532 4:4369795-4369817 ATTTTGAGATAGAGCCTGTGAGG - Intronic
969901991 4:10358691-10358713 ATTTTGATATTGGTCATTTGTGG + Intergenic
970375583 4:15453970-15453992 ATTGTGAGATGCTGCCTTGGTGG + Intergenic
970468880 4:16356025-16356047 ATTTTGAGATAGGACCTTTAGGG - Intergenic
970779053 4:19713588-19713610 ATTTTTAGATGGTTGTTTGGGGG - Intergenic
971357132 4:25905352-25905374 ATTTGGAGATGGGGCCTCTGGGG + Intronic
971545862 4:27885701-27885723 ATTTTGAGAAGTTTCTATTGAGG + Intergenic
972678657 4:41284844-41284866 ATTTGGAGATGGGGCCTTTGGGG - Intergenic
972709814 4:41583935-41583957 ATTTTGTGGTGTTTCCTTTCTGG + Intronic
973718621 4:53701739-53701761 ATTTGGAGATGAGTCCTTTCTGG + Intronic
974658003 4:64849625-64849647 AATTTGAGATGGTTTCTTGGAGG + Intergenic
974868540 4:67609609-67609631 ATTTGGAGATGGGGCCTTTGAGG - Intergenic
976974017 4:91144487-91144509 ATTTTCTTATGGTACCTTTGGGG + Intronic
977133225 4:93268402-93268424 ATTTGGAGATGGGGCCTATGAGG - Intronic
977164949 4:93683093-93683115 TTTTTAAGATGTTACCTTTGGGG + Intronic
977170553 4:93756656-93756678 ATTTTGAGATGGGGCCTTTGGGG - Intronic
977184702 4:93922023-93922045 ACTTGGTGATGGTTACTTTGAGG + Intergenic
977676001 4:99747771-99747793 ATTAAGAGATGGAGCCTTTGAGG + Intergenic
978011747 4:103694528-103694550 AGTTTGAAATGGTTTCTTTAAGG + Intronic
978389457 4:108209558-108209580 ATTTGCAGATTGTACCTTTGTGG + Intergenic
978672347 4:111264869-111264891 ATTTGCAGATGGTTTATTTGGGG - Intergenic
978816637 4:112914010-112914032 ACTTTGAGATAGTTTTTTTGGGG + Intronic
978904447 4:113989072-113989094 AATTTTAGATCTTTCCTTTGTGG - Intergenic
979554894 4:122034372-122034394 AGTTTGAGATGGTACATTTTTGG + Intergenic
980211316 4:129792022-129792044 ATATTGAAATGTTTCCTTTTAGG + Intergenic
980271749 4:130593173-130593195 ATTTTGAGATGGCTACTTAGAGG + Intergenic
985077309 4:186228692-186228714 TTTTTGAAATGGTTCCCTAGCGG - Intronic
985980310 5:3457031-3457053 CATTTGAGCTGGCTCCTTTGTGG - Intergenic
986240641 5:5956665-5956687 ATTAAGAGGTGGTGCCTTTGGGG + Intergenic
988280160 5:29134738-29134760 AGGCTGAGATGGTTCCTTTGAGG + Intergenic
989413535 5:41147705-41147727 AGTTAGAGATATTTCCTTTGTGG - Intronic
989534615 5:42549634-42549656 CTTCTGAGAAGATTCCTTTGTGG + Intronic
989703833 5:44303632-44303654 ATTTTGATATGGTTACATTATGG + Exonic
989715064 5:44453503-44453525 ATTTTGAGATGGCTACTCAGAGG - Intergenic
991066740 5:62432060-62432082 AAACTGAAATGGTTCCTTTGAGG + Intronic
991533496 5:67640429-67640451 ATTGTAAAATGGGTCCTTTGTGG + Intergenic
991540794 5:67725938-67725960 ATTTTTAGATTGTTTATTTGAGG - Intergenic
992965444 5:81995075-81995097 TTTTTGAGATGCAACCTTTGAGG + Intronic
994105974 5:95949226-95949248 ATTCTGACATGATTCCTTTGGGG + Intronic
994155949 5:96504404-96504426 ATTTCAAGCTGGTTCCTGTGTGG - Intergenic
994581524 5:101648626-101648648 TTTTTGAAATGCTTTCTTTGAGG - Intergenic
995582357 5:113615391-113615413 AATTTGAAATGGTTCCTTTCAGG - Intergenic
995705624 5:114986256-114986278 AGTTTGAGCTCCTTCCTTTGTGG - Intergenic
996283935 5:121766705-121766727 ATTTTGAGATGGCTGCTTCTAGG - Intergenic
998826978 5:146112365-146112387 CCTTTGTGTTGGTTCCTTTGGGG - Intergenic
998902418 5:146870291-146870313 ATTTGGAGATAGGTCCTTTAAGG + Intronic
999655819 5:153809605-153809627 TTTTTGAGATGGATCCTAGGTGG + Intronic
999982966 5:156975565-156975587 ATTTTTACATGTTTCCATTGAGG - Intergenic
1000950184 5:167472237-167472259 CTTTTAAGATGTTTCCTTTAAGG - Intronic
1001709534 5:173767209-173767231 CTTATGAGAAGGTTCCTTGGAGG + Intergenic
1001886791 5:175299473-175299495 ATTTGGAGATGGGCCTTTTGGGG + Intergenic
1003251395 6:4431895-4431917 ATTTGGAGATGGGGCCTTTGTGG - Intergenic
1003718448 6:8673688-8673710 ATTTGGAGATGGGGCCTGTGAGG + Intergenic
1004195580 6:13501211-13501233 ATTTGGAGGTGGTGTCTTTGGGG - Intergenic
1004288945 6:14349095-14349117 ATTTGGAGATGGATCCTTTATGG - Intergenic
1004402286 6:15299840-15299862 AGTTTGACCTGGTTGCTTTGAGG + Intronic
1005482180 6:26265377-26265399 ATTTTGAGATGGCTCTTTGGAGG - Intergenic
1007060231 6:38933156-38933178 ATTTTGAGATGATTCCTCGCTGG + Intronic
1009973161 6:70645997-70646019 ATTTGGAGATGGAGCCTTTAGGG - Intergenic
1010010082 6:71038955-71038977 ATTTTATGCAGGTTCCTTTGAGG - Intergenic
1010807656 6:80257955-80257977 ATGTTGTGATGGTTAATTTGAGG - Intronic
1011801285 6:91019000-91019022 ATTTGGAGATGGGACCTTTGTGG - Intergenic
1012542457 6:100377376-100377398 ATCTTTACATGGGTCCTTTGGGG + Intergenic
1012558820 6:100552658-100552680 ATTTTGAGTTAGTTCCACTGAGG - Intronic
1012869523 6:104657088-104657110 TTTTTGAGTTGATTCTTTTGCGG - Intergenic
1013334781 6:109145298-109145320 ATTCTGAGATGGTTCATTCTGGG - Exonic
1013731360 6:113171906-113171928 ATTTTTAGATGGGGCCTTTAAGG + Intergenic
1014217978 6:118771176-118771198 ACTTTGAGATGGATCCTGAGTGG - Intergenic
1015904565 6:138103498-138103520 ATTTTGAGATTATGCCCTTGTGG - Intronic
1016257232 6:142122064-142122086 AGTTTGAAATGGTTCCTTTAAGG + Intergenic
1017087947 6:150731901-150731923 ATTTTCACATGGGTCCTTTTGGG + Intronic
1017664920 6:156710351-156710373 ATTTTGGGATGGTACCTATAAGG - Intergenic
1017913553 6:158815453-158815475 TTTTTGAGAGGCTTCCTTTTAGG - Intronic
1019902793 7:4036646-4036668 GTTAGGAGATGGTGCCTTTGAGG + Intronic
1020609880 7:10382214-10382236 ATTTTGAGATTTTTCTTATGTGG - Intergenic
1021462165 7:20900822-20900844 ATTTGGAGATGGAGCCTTTGCGG - Intergenic
1022198840 7:28096011-28096033 ATTTGGAGATGGAGCCTTTGAGG - Intronic
1023582405 7:41696743-41696765 ATTTTGAGATGGCTTTCTTGGGG + Intronic
1024029651 7:45448243-45448265 ATTTTGAGATGGTTGCCATGGGG + Intergenic
1024161432 7:46680438-46680460 ATTTGGAGATGGTTGGTTCGGGG + Intronic
1024431173 7:49289724-49289746 AATTTGACATGCTTGCTTTGTGG + Intergenic
1024912539 7:54462430-54462452 ATTTTCAGATGCATTCTTTGTGG - Intergenic
1027203836 7:76081332-76081354 ATTGTAAGATGGTTTATTTGTGG - Intergenic
1027903870 7:84153507-84153529 ATTTTACGCTGTTTCCTTTGGGG - Intronic
1029269807 7:99370395-99370417 TATTTGAAATGGCTCCTTTGGGG - Intronic
1029661042 7:101962002-101962024 ATTTTGGCATGGTTCCTTCCAGG - Intronic
1030022017 7:105284887-105284909 ATTTTTAGTTGGTGCCTATGTGG - Intronic
1030033108 7:105387618-105387640 ATTTTTGGTTGTTTCCTTTGAGG - Intronic
1030388822 7:108900262-108900284 ATTTGGAGATGGAGCCTTTAAGG - Intergenic
1031194995 7:118602016-118602038 ATTCAGAGAGGTTTCCTTTGAGG + Intergenic
1031276896 7:119736029-119736051 ATTTTGAGATAGGACCTTTAGGG - Intergenic
1031534927 7:122921841-122921863 CTTTTGAGATGGTTCTTTTGAGG - Intergenic
1032533427 7:132640410-132640432 ATTTGGAGATAGGGCCTTTGGGG + Intronic
1033045710 7:137960648-137960670 AATTTCAGATGGTTCCCCTGTGG - Intronic
1033086424 7:138346034-138346056 ATCTTGAAATGCTTGCTTTGGGG - Intergenic
1033729743 7:144165755-144165777 AGTTTGAGATTGTGTCTTTGAGG + Intergenic
1034332386 7:150294177-150294199 ATTGTCAGATGTTCCCTTTGGGG - Intronic
1034665651 7:152815701-152815723 ATTGTCAGATGTTCCCTTTGGGG + Intronic
1034821440 7:154220151-154220173 ATCAAGAGATGGGTCCTTTGCGG + Intronic
1035058852 7:156054263-156054285 AGTTGGAGATGGTGCTTTTGGGG - Intergenic
1037197658 8:16211042-16211064 AATTTGAGATGGCTACTATGAGG + Intronic
1038337361 8:26656121-26656143 ATTTTAAGAAGTTTTCTTTGTGG + Exonic
1039394797 8:37216297-37216319 ATCTTGATTTGGTTACTTTGAGG - Intergenic
1039486351 8:37913107-37913129 ATTTTGAGATGGTTGTTCAGAGG + Intergenic
1039626005 8:39053934-39053956 ATTTGGAGATGGGGCCTTTAAGG + Intronic
1039894324 8:41705539-41705561 CTTTTAATATGGTTCCCTTGTGG + Intronic
1040406041 8:47103724-47103746 ATTTTAATTTGATTCCTTTGTGG - Intergenic
1040656052 8:49509353-49509375 ATTTTGACATGGATCGTTTTGGG - Intergenic
1041311332 8:56520085-56520107 AATTTGAACTTGTTCCTTTGGGG - Intergenic
1042583224 8:70305265-70305287 AGTTTGTGCTGGTTCCTCTGAGG - Intronic
1043448940 8:80347431-80347453 ATTTTTAGATGGTCCTTTTGTGG - Intergenic
1043715545 8:83480864-83480886 ATATATAGATGGTTCTTTTGAGG + Intergenic
1043928005 8:86059847-86059869 ATTTTGAGATGGCTCTTTAGAGG + Intronic
1044511624 8:93086975-93086997 ATTTTGAGATGGGTCATTCATGG + Intergenic
1044544887 8:93448661-93448683 ATTAGGAGGTGGTACCTTTGGGG + Intergenic
1044999178 8:97865586-97865608 ATGTCCAGAGGGTTCCTTTGAGG - Intergenic
1045692397 8:104773422-104773444 ATTCTGAGAAGGATCCTGTGTGG - Intronic
1045885772 8:107096473-107096495 AATTTGAAATGGTTTCTTTAAGG - Intergenic
1046256229 8:111699661-111699683 ATTTTGAAATAGAGCCTTTGTGG + Intergenic
1046463587 8:114572709-114572731 ATTTTGGCATGATTCCTTGGGGG - Intergenic
1046472988 8:114703458-114703480 ATTTAGAGATGTTTTGTTTGGGG - Intergenic
1047226718 8:122961317-122961339 ATTTGGAGATAGTGCCTTTAAGG - Intronic
1048410244 8:134164832-134164854 ATTAGGAGATGATGCCTTTGGGG - Intergenic
1048821054 8:138381226-138381248 ATTTTGAGAGGGTTTGTTTGTGG - Intronic
1048963826 8:139600822-139600844 ACTCTGAGATGCTGCCTTTGTGG - Intronic
1050068866 9:1789637-1789659 ATTTTCAGTTATTTCCTTTGTGG - Intergenic
1050315638 9:4398184-4398206 ATTTTGTGAGGATTCCATTGGGG - Intergenic
1050589324 9:7146209-7146231 ATTTTGATGTATTTCCTTTGAGG - Intergenic
1050772644 9:9221677-9221699 ATTTGGAGATAGGGCCTTTGAGG - Intronic
1051371132 9:16360169-16360191 ATTAGGAGATGGGGCCTTTGAGG - Intergenic
1051462770 9:17341591-17341613 CTTTTGAGATGGATCCTTTAGGG + Intronic
1051550985 9:18329059-18329081 ATTTGGAGGTGGGGCCTTTGGGG + Intergenic
1051668042 9:19483813-19483835 ATTTGGAGATGGGGCGTTTGGGG + Intergenic
1051976339 9:22954188-22954210 ATTTTAAAAAGGTTCTTTTGGGG + Intergenic
1052566174 9:30155017-30155039 ATTTTGAAATTCTTCCTGTGAGG - Intergenic
1055228215 9:74027432-74027454 ATTTTGTGATAGTTCCTCAGAGG + Intergenic
1055540650 9:77301635-77301657 ACTTTGAGATTGTCACTTTGAGG + Intronic
1055592408 9:77830776-77830798 ATTTGGATATGTTTCCATTGTGG + Intronic
1056736989 9:89218649-89218671 ATTTTGATTTGCTTCATTTGGGG - Intergenic
1057813326 9:98274606-98274628 ATTAAGAGATGGAGCCTTTGGGG + Intergenic
1058281805 9:103125653-103125675 AATTTGAGATGGTGTCTTGGAGG + Intergenic
1059148719 9:111927170-111927192 ATTTTAAAAAGGTTCTTTTGAGG - Intronic
1059275836 9:113096466-113096488 ATTAAGAGGTGGTGCCTTTGTGG - Intergenic
1060274807 9:122174309-122174331 ATGTTCAGAAAGTTCCTTTGGGG + Intronic
1060796827 9:126517529-126517551 GTTTTGAAATGTTTACTTTGTGG - Intergenic
1061945060 9:133904083-133904105 ATTTTGAGCTGCTTCCTATCCGG + Intronic
1185942193 X:4334101-4334123 ATTTGGAGATGGTTTCTTTAAGG + Intergenic
1187306144 X:18097005-18097027 ATTTGGAGATAGTGCTTTTGAGG - Intergenic
1187348904 X:18493802-18493824 ATTTTAACACGGTTTCTTTGGGG - Intronic
1188860976 X:35255568-35255590 ATTGTCAGTTGGTTCTTTTGTGG - Intergenic
1189259927 X:39671037-39671059 GTTTGGAGATGGTGCCTTTAAGG + Intergenic
1189619561 X:42821237-42821259 ATTTTGAGATGGTTGTTCAGAGG + Intergenic
1190229896 X:48574208-48574230 AGATTGAGAAGGTTCCTTTGTGG + Intergenic
1192978144 X:76308005-76308027 ATTTTTATATGGTTACTTGGAGG - Intergenic
1193464466 X:81831191-81831213 ATTTTGAGGGGGATACTTTGAGG + Intergenic
1193912184 X:87318603-87318625 AGTTTGCAATGGTTCCTTTTTGG + Intergenic
1194130697 X:90078255-90078277 ATTTTGAGATGGTTATTCGGAGG + Intergenic
1194652452 X:96532541-96532563 ACTTGGAGATGGTTTCTTTGAGG - Intergenic
1195125096 X:101800835-101800857 ATTTGGAGGTGGGGCCTTTGGGG + Intergenic
1195179646 X:102344785-102344807 ATTTGGAGGTGGGGCCTTTGGGG - Intergenic
1195609989 X:106855374-106855396 ATTTTAAGATGGTTACTTCTGGG - Intronic
1195741375 X:108068146-108068168 AATGTCAGCTGGTTCCTTTGTGG - Intronic
1195807698 X:108794592-108794614 AATTTGAAATAGTTACTTTGAGG - Intergenic
1196184851 X:112735110-112735132 ATTTGGAGGTGGGGCCTTTGGGG + Intergenic
1196336264 X:114539773-114539795 TTTTTGAGATAGTTGCTTAGTGG - Intergenic
1196427807 X:115589876-115589898 ATTTTGAGATGGAGTCTCTGTGG + Intronic
1198006351 X:132498476-132498498 ATTTTGAGAGGGGTTTTTTGAGG - Intergenic
1199101594 X:143807707-143807729 ATTCTGTGATTGTTACTTTGGGG + Intergenic
1200051648 X:153435128-153435150 AGCTTGAGATGGTTCCTCTGAGG + Intergenic
1201316677 Y:12654108-12654130 TTTTTCAGATTGTTCCTTGGAGG + Intergenic