ID: 964835227

View in Genome Browser
Species Human (GRCh38)
Location 3:160930654-160930676
Sequence CTCCGCCTAAAATTTTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 82}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964835227_964835233 20 Left 964835227 3:160930654-160930676 CCATCTCAAAATTTTAGGCGGAG 0: 1
1: 0
2: 1
3: 4
4: 82
Right 964835233 3:160930697-160930719 GCTTCGTATGGGAAACACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 48
964835227_964835231 8 Left 964835227 3:160930654-160930676 CCATCTCAAAATTTTAGGCGGAG 0: 1
1: 0
2: 1
3: 4
4: 82
Right 964835231 3:160930685-160930707 TTTAAGAGGGAAGCTTCGTATGG 0: 1
1: 0
2: 0
3: 7
4: 101
964835227_964835230 -5 Left 964835227 3:160930654-160930676 CCATCTCAAAATTTTAGGCGGAG 0: 1
1: 0
2: 1
3: 4
4: 82
Right 964835230 3:160930672-160930694 CGGAGTGAAGGAGTTTAAGAGGG 0: 1
1: 3
2: 9
3: 18
4: 177
964835227_964835232 9 Left 964835227 3:160930654-160930676 CCATCTCAAAATTTTAGGCGGAG 0: 1
1: 0
2: 1
3: 4
4: 82
Right 964835232 3:160930686-160930708 TTAAGAGGGAAGCTTCGTATGGG 0: 1
1: 0
2: 0
3: 3
4: 73
964835227_964835234 25 Left 964835227 3:160930654-160930676 CCATCTCAAAATTTTAGGCGGAG 0: 1
1: 0
2: 1
3: 4
4: 82
Right 964835234 3:160930702-160930724 GTATGGGAAACACGCAGGAGTGG 0: 1
1: 2
2: 3
3: 16
4: 151
964835227_964835229 -6 Left 964835227 3:160930654-160930676 CCATCTCAAAATTTTAGGCGGAG 0: 1
1: 0
2: 1
3: 4
4: 82
Right 964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG 0: 1
1: 1
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964835227 Original CRISPR CTCCGCCTAAAATTTTGAGA TGG (reversed) Intronic
906781709 1:48578578-48578600 CTCCACCGAAAATTTAGTGAAGG + Intronic
908673958 1:66580123-66580145 ATCTGCCTTAAATTTTGAAAGGG - Intronic
909727363 1:78851468-78851490 CCTCCCCTAAAATCTTGAGATGG + Intergenic
916617023 1:166452395-166452417 CTCTGCCTAAAATTCTGTGTGGG + Intergenic
1065007415 10:21392773-21392795 CTCTGCCTAAAACTTGGAGCTGG - Intergenic
1065910691 10:30301966-30301988 CTCCCCCTCAAATTTTTTGATGG + Intergenic
1070159332 10:73856352-73856374 CTTTGCCTAAGAATTTGAGAAGG - Intronic
1074648813 10:115494877-115494899 CTCCTTCTAAAATTTTGGAATGG + Intronic
1079307020 11:19332421-19332443 CTCTGCAGAAAATTTTGAAAAGG - Intergenic
1079363484 11:19789376-19789398 CTCTCCCTGAAAGTTTGAGAAGG - Intronic
1093152434 12:15638412-15638434 CTCAGCCCAAAATTTTCAGGAGG + Intronic
1093199960 12:16174645-16174667 TTCAGCCTATAAATTTGAGAGGG + Intergenic
1093631483 12:21414624-21414646 CTGCACCTAACATTTAGAGATGG - Intronic
1097720478 12:63014704-63014726 CTCACCTTAAAATTTTGATATGG - Intergenic
1098280671 12:68859799-68859821 GTACTCCTGAAATTTTGAGAGGG - Intronic
1098514714 12:71360662-71360684 CTCCACCTAAAATTTTGATATGG + Intronic
1099125697 12:78754424-78754446 GTCAGACTAAAAGTTTGAGAAGG + Intergenic
1100108792 12:91211252-91211274 ATCCACCTAAAAATTTCAGATGG + Intergenic
1102780622 12:115561523-115561545 CTGCTTCTAAAATTTTGAGCTGG + Intergenic
1108079690 13:46722238-46722260 CTCTGCCCAAAATTTTCTGAGGG + Intronic
1109441210 13:62377605-62377627 CACCACCTAAAATTTGGACAAGG - Intergenic
1114842032 14:26275353-26275375 TCCCGCCTAACATTTTGAAAAGG + Intergenic
1119486437 14:74991045-74991067 CTTGGCCTATACTTTTGAGATGG + Intergenic
1123510972 15:20999753-20999775 CTCCCCCTAAAAATTGGACAGGG - Intergenic
1123568195 15:21573512-21573534 CTCCCCCTAAAAATTGGACAGGG - Intergenic
1123604302 15:22008834-22008856 CTCCCCCTAAAAATTGGACAGGG - Intergenic
1123868813 15:24551020-24551042 CTCTGCCCAAAATTTTGAACTGG - Intergenic
1124168959 15:27355005-27355027 CTCTGCCAATAATTATGAGAGGG + Intronic
1127711382 15:61602080-61602102 CTCCTCATGAAATTTTGATATGG - Intergenic
1202976552 15_KI270727v1_random:300600-300622 CTCCCCCTAAAAATTGGACAGGG - Intergenic
1138248680 16:55485725-55485747 CACCACCTACAACTTTGAGAAGG + Exonic
1140882950 16:79215367-79215389 ATCAGCCTAAGATTTTAAGATGG - Intergenic
1154313359 18:13284496-13284518 TTCCACCTAAAATTTTGTGGGGG + Intronic
1156197771 18:34795023-34795045 CTCAGCCTACAATTTCAAGAGGG + Intronic
1162841545 19:13360044-13360066 CTTTTCCTAAACTTTTGAGATGG + Intronic
1164545341 19:29156839-29156861 CTCAGCTTCAAACTTTGAGATGG + Intergenic
925777854 2:7352466-7352488 CTCTGCTTAAAATTCTGGGAAGG + Intergenic
926176643 2:10598736-10598758 CTCCTCCTAAACTTTTGATACGG - Intronic
930236466 2:48893502-48893524 ACCTGCCAAAAATTTTGAGAAGG + Intergenic
937044852 2:118845813-118845835 CTCCGCAGAAAATATCGAGATGG + Intronic
941946434 2:171103435-171103457 GTCCGGCTAATTTTTTGAGATGG + Intronic
944901496 2:204221226-204221248 CTCAGCCTAAGAGTTTGATATGG - Intergenic
945143086 2:206708197-206708219 CTTCTCCTAAAATTTTTACAAGG + Intronic
948148181 2:235724164-235724186 TTCTGCCTAAAATTTTGAGTTGG - Intronic
1175340314 20:58224990-58225012 CCCCGCCCCAAATTTTGAGGTGG + Intronic
1179078426 21:38146455-38146477 CTCCCAGTAAAATGTTGAGAAGG + Intronic
955864840 3:63371771-63371793 CTCCGACTAAAGTGTTGAGGTGG - Intronic
956298547 3:67742195-67742217 CTCCGCTTCAATTTTTGAAATGG + Intergenic
957895726 3:86419226-86419248 CTCAGCCCAAAAATTTGAAATGG + Intergenic
959937463 3:112044280-112044302 CTGCTCATAAAATTTGGAGAAGG - Exonic
964835227 3:160930654-160930676 CTCCGCCTAAAATTTTGAGATGG - Intronic
966735884 3:183186721-183186743 CTCCACAAAAACTTTTGAGACGG - Intronic
968205642 3:196797456-196797478 CCCAGCCTATTATTTTGAGAGGG - Intronic
972170207 4:36336441-36336463 CTCTGCCCAAAATGTTGAAATGG - Intronic
974621985 4:64368236-64368258 CTCCATCTAAAATGTTGACAAGG + Intronic
976007372 4:80445978-80446000 CTCCGCCTGAAAGTTTGAAATGG + Intronic
979023297 4:115531305-115531327 CTCCTCCTAAAATATCTAGAAGG - Intergenic
980471013 4:133251591-133251613 CCCAGCCTGAAATTTTGTGAAGG - Intergenic
982094051 4:151905004-151905026 CTTAGCCTGAAAATTTGAGATGG - Intergenic
984155527 4:176191808-176191830 CATCTCCTAAAATTGTGAGATGG - Intronic
984238561 4:177191646-177191668 CTCGGCCTAATAATTTGAAAGGG - Intergenic
992763939 5:79977655-79977677 CTAGGCCTGCAATTTTGAGAGGG - Intronic
993595922 5:89855389-89855411 TTCCCTCTAACATTTTGAGATGG + Intergenic
1004913227 6:20306963-20306985 CTCTGCCTAAAATTTTTCAATGG - Intergenic
1008260498 6:49360291-49360313 CTCCTTCTAAAATTTTTAAATGG + Intergenic
1010810877 6:80297904-80297926 CAGAGCCTTAAATTTTGAGAGGG + Intronic
1012215444 6:96577075-96577097 CTTTGCCTAAATTTCTGAGAGGG + Intronic
1014002848 6:116384274-116384296 ATGGGCCGAAAATTTTGAGATGG + Intronic
1014738508 6:125122343-125122365 CAGAGCCTTAAATTTTGAGAGGG - Intronic
1028379889 7:90188334-90188356 CTTAGCTTAAAAATTTGAGATGG - Intronic
1028706852 7:93859073-93859095 CTCTGCTCAAAATTTTTAGACGG + Intronic
1029046466 7:97634589-97634611 CTCCCCATATAATTTTGATATGG - Intergenic
1031534929 7:122921852-122921874 TTCAGCCTAAACTTTTGAGATGG - Intergenic
1032968295 7:137128972-137128994 CTCTGCCTTAAATTTAGAGCTGG + Intergenic
1033712503 7:143962801-143962823 GTCCGTCAAAAATTTTTAGAAGG + Intergenic
1035167793 7:157002016-157002038 CTCCAAATAAAATTTTGAAACGG - Intronic
1043189317 8:77197902-77197924 CTCTGACTAAAGTGTTGAGAAGG + Intergenic
1044754604 8:95448047-95448069 CTCCCCCTGAACTTTAGAGAGGG + Intergenic
1048921867 8:139238704-139238726 CTCTGCCTAATTGTTTGAGATGG + Intergenic
1051317654 9:15859426-15859448 CTCCTCCAAAAAATTTGAAAAGG - Intronic
1059890083 9:118792105-118792127 CTCTTCCTAAAATTTGGAAATGG - Intergenic
1187143630 X:16617835-16617857 CTCCACCTTAACTTTTGACAGGG - Intronic
1189026913 X:37404706-37404728 GTCCGCATAAAATTTTTTGAGGG + Intronic
1194187824 X:90794972-90794994 CACAGCCTTACATTTTGAGAGGG - Intergenic
1194539812 X:95156492-95156514 CTCCAACTAAAATGTTCAGATGG - Intergenic
1196408116 X:115387079-115387101 CTTCACCTAAATTTTTTAGAAGG + Intergenic
1197290046 X:124644546-124644568 ATCCCCCCAAAATTTTGAAATGG - Intronic
1200534411 Y:4376921-4376943 CACAGCCTTACATTTTGAGAGGG - Intergenic