ID: 964835229

View in Genome Browser
Species Human (GRCh38)
Location 3:160930671-160930693
Sequence GCGGAGTGAAGGAGTTTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964835227_964835229 -6 Left 964835227 3:160930654-160930676 CCATCTCAAAATTTTAGGCGGAG 0: 1
1: 0
2: 1
3: 4
4: 82
Right 964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG 0: 1
1: 1
2: 0
3: 7
4: 108
964835223_964835229 16 Left 964835223 3:160930632-160930654 CCAGGCTGAAGCCTCAAAGGAAC 0: 1
1: 0
2: 4
3: 14
4: 121
Right 964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG 0: 1
1: 1
2: 0
3: 7
4: 108
964835224_964835229 5 Left 964835224 3:160930643-160930665 CCTCAAAGGAACCATCTCAAAAT 0: 1
1: 0
2: 4
3: 49
4: 399
Right 964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG 0: 1
1: 1
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964835229 Original CRISPR GCGGAGTGAAGGAGTTTAAG AGG Intronic
902039755 1:13484092-13484114 GCGGAGTGGAGGGGTTTAGCAGG - Intronic
902106712 1:14043059-14043081 GGGGATTGAAGGAGTTTAGTTGG - Intergenic
903185430 1:21626310-21626332 GTAGAGTGAAGGAGTATAGGAGG + Exonic
906280258 1:44548447-44548469 GCTGAATGAAGGAGTCTAGGTGG - Intronic
907802074 1:57778949-57778971 GTGGAGTGAAGGAGGGAAAGAGG - Intronic
908337870 1:63145721-63145743 GCTGAGTAAAGGAGTTTGGGAGG - Intergenic
910451539 1:87351617-87351639 GCTCTGTGAGGGAGTTTAAGGGG + Intergenic
917200715 1:172511723-172511745 GTGGAGTAAAGGACTATAAGGGG - Intergenic
917226659 1:172790802-172790824 GAGGAGGGAAGGAGGTTCAGAGG + Intergenic
917460236 1:175223072-175223094 GTGGAGTGATGGAGCTGAAGTGG - Intergenic
921372981 1:214444619-214444641 GCAGATTGCAGGAGTCTAAGGGG + Intronic
923001490 1:230009727-230009749 TCTGAGTGAAGTAGTTTATGTGG + Intergenic
923118607 1:230968772-230968794 ACGGAAACAAGGAGTTTAAGAGG + Intronic
923259094 1:232249771-232249793 GGGCAGGGAAGGAGATTAAGTGG - Intergenic
1064931124 10:20628429-20628451 GAGGAGAGAAAGAGATTAAGAGG + Intergenic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1074272714 10:111971010-111971032 GGGGAGTTAAGGGGTTTGAGGGG - Intergenic
1074891046 10:117736870-117736892 GCGGAATGAGGGAGTCTGAGGGG + Intergenic
1075324970 10:121524262-121524284 GGGGAGTGGAGGTGGTTAAGAGG - Intronic
1080008288 11:27432248-27432270 GGGGAGAGAAGGTGTTCAAGTGG - Intronic
1087418409 11:97888370-97888392 GTGAAATGAAGGAGTTTAATGGG - Intergenic
1089634199 11:119801879-119801901 CCGGAGTGAAGGCTTTGAAGTGG + Intergenic
1094042577 12:26133294-26133316 GGGGAGTGAGGGAGATGAAGGGG - Intronic
1096415599 12:51409887-51409909 GCTGAGTAAAGGGATTTAAGAGG + Intronic
1100796046 12:98182850-98182872 GCCCAGTAAAAGAGTTTAAGAGG - Intergenic
1100878944 12:98995006-98995028 TCTGAGTGAATGAGTTAAAGAGG + Intronic
1102898854 12:116620483-116620505 GCGGAGGGAAGGCGTGTTAGAGG - Intergenic
1112314337 13:98348043-98348065 AGGATGTGAAGGAGTTTAAGGGG + Intronic
1113335318 13:109371214-109371236 GAGGAGTGCAGGGGTTTCAGCGG - Intergenic
1114535491 14:23419652-23419674 GGGGAATGAAGGGGTGTAAGAGG + Intronic
1116702757 14:48261264-48261286 GCAGAGTGAAATATTTTAAGTGG + Intergenic
1120057515 14:79942249-79942271 AGGGAGTGAAGGAGTTTGAGTGG + Intergenic
1122890162 14:104728536-104728558 AGGGAGTGAAGCAGTGTAAGTGG + Intronic
1123584091 15:21741871-21741893 TTGGAGTGAGGGATTTTAAGAGG - Intergenic
1123620741 15:22184474-22184496 TTGGAGTGAGGGATTTTAAGAGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1130976745 15:88782362-88782384 GAGGAGTGCAGGAGTTCAGGGGG + Intergenic
1136192972 16:28629403-28629425 GCGGAGTGAAACACTTTAAATGG + Intergenic
1140533186 16:75684364-75684386 GTGGAGGGAAGGTGTTTAAATGG + Intronic
1142157457 16:88539159-88539181 GAGGAGAGAAGGAGTTTCACAGG - Intergenic
1143363515 17:6390182-6390204 TCTGGGTGAAGGAGTTTAAGTGG - Intergenic
1143764822 17:9130556-9130578 TCTGAGTGGATGAGTTTAAGGGG - Intronic
1143778079 17:9212592-9212614 CCAGGGTGAAAGAGTTTAAGGGG - Intronic
1145972935 17:28967593-28967615 CCAGAGTGGAGGAGGTTAAGAGG + Intronic
1151099500 17:71540453-71540475 GCTGAATGAAGGGGTTTTAGAGG + Intergenic
1155400819 18:25437347-25437369 GAGGTATGTAGGAGTTTAAGTGG - Intergenic
1157010456 18:43642245-43642267 GAGGAGAGAGGGAGTGTAAGAGG - Intergenic
1162103076 19:8352432-8352454 GAGGAGGGAAGTTGTTTAAGAGG - Intronic
1163549806 19:17959758-17959780 CCCGAGTGAAAGAGTTCAAGAGG + Intronic
1166619714 19:44285273-44285295 GCTGAGTGAAGGAGTTTAAGAGG - Intronic
933557918 2:83853403-83853425 GCTGAGTGAATGATTTTTAGTGG - Intergenic
933979934 2:87541093-87541115 CTGGAGTGATGGACTTTAAGTGG - Intergenic
936313887 2:111409698-111409720 CTGGAGTGATGGACTTTAAGTGG + Intergenic
939304710 2:140396204-140396226 GCTGGTTGAAGGAGCTTAAGTGG - Intronic
942064258 2:172255324-172255346 GTGGGGTGGAGGAGGTTAAGAGG - Intergenic
1168956245 20:1836461-1836483 GCAGAGTGAAGGAGGTGGAGAGG - Intergenic
1170207246 20:13811594-13811616 GCAGGGTGAAGGTGTTTAATAGG + Intronic
1178425294 21:32474252-32474274 GCAGAGTGGAGGGCTTTAAGCGG - Intronic
1181652889 22:24270741-24270763 GCGCAGTGAAGGAATGTAGGCGG + Intergenic
1184037560 22:41925989-41926011 GGGGAGAGAAGGGCTTTAAGGGG - Intronic
949427404 3:3933630-3933652 GGGGAGTGAAATATTTTAAGTGG + Intronic
949844302 3:8354283-8354305 GTGCATTGAAGGAGTTTAATAGG + Intergenic
954161689 3:48727366-48727388 CCAGAGTGGGGGAGTTTAAGGGG + Intronic
954225120 3:49176273-49176295 CCGGAGCGCAGGAGTTCAAGTGG + Exonic
956977000 3:74592313-74592335 GTGGAGTAAAGGAGTTTAACAGG + Intergenic
957895724 3:86419209-86419231 GCTGAGTGATGGTGTTTAAAAGG - Intergenic
961804535 3:129479813-129479835 GCGGAGTGAAGGAGCGGGAGTGG + Exonic
962935957 3:140080989-140081011 GTGGAGTGAAGGATATTCAGAGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
967787681 3:193514960-193514982 GCAGAGTGAAGGAGTTGAGGAGG + Intronic
967951944 3:194847996-194848018 GTGGAGTGAAGGGCTTTAAAAGG - Intergenic
967983797 3:195080764-195080786 GCGGATTGATGGAGTCTAACTGG - Intronic
974713187 4:65630299-65630321 GAGAAGTGATGGAGTTTAACTGG + Intronic
975373693 4:73617591-73617613 GCCTAGTAAAGGAGCTTAAGAGG - Intronic
976455791 4:85245910-85245932 GTGGAGAGAAGGAGTTTAACAGG - Intergenic
978018563 4:103779482-103779504 GAAGAGTGAAGGAGTTTCTGTGG - Intergenic
980621783 4:135316694-135316716 GCAAAGTGATGGAGTTTAAATGG - Intergenic
982269598 4:153572845-153572867 GCTGAGGGAAGGTGTTTAATGGG - Intronic
984211831 4:176859340-176859362 GGGGAGTGGAGGAGTCCAAGAGG + Intergenic
986830568 5:11572589-11572611 GAGGAGGGAAGAAGTTGAAGTGG - Intronic
988418312 5:30974452-30974474 GAGGAGGGAAGGAGTTGCAGAGG - Intergenic
990285008 5:54292409-54292431 GTGGAGGGCAGGAGTTTCAGTGG - Intronic
993602870 5:89950363-89950385 GTGGAGTGCAGGAGTTGAAATGG + Intergenic
994770334 5:103973567-103973589 CCTCAGTGAAGGAGTTTCAGTGG + Intergenic
1000107282 5:158072102-158072124 GGGGTGTGAAGGGGTTGAAGGGG + Intergenic
1002208075 5:177577984-177578006 GAGGAGTGATGGAGATTATGAGG - Intergenic
1003359766 6:5413643-5413665 AAGGAGTGAAGGAGTTAAAGTGG - Intronic
1006163747 6:32052832-32052854 GCACAGTGAAGGAGTCGAAGCGG + Intronic
1009059833 6:58385565-58385587 GTGGAATGAATGAGTTTGAGAGG + Intergenic
1009231079 6:61061831-61061853 GTGGAATGAATGAGTTTGAGAGG - Intergenic
1010083579 6:71889230-71889252 GGAGAGTGAGGGATTTTAAGTGG + Intronic
1010160814 6:72852616-72852638 GTGGAGAGAAGGAGATGAAGGGG + Intronic
1010535295 6:77020469-77020491 GGGGAGTTGAAGAGTTTAAGAGG + Intergenic
1011113757 6:83867106-83867128 GCAGAGTGAAGCACCTTAAGAGG + Intronic
1013588708 6:111602414-111602436 ACGGAGTGAAGGAGAGGAAGGGG + Intronic
1014613117 6:123568561-123568583 GCAGAGTGCAAGAGTTAAAGAGG - Intronic
1019451008 7:1098022-1098044 GCGTCGTGAAGGATTTTATGGGG + Intronic
1022624655 7:32022518-32022540 GGGGAATGAAGTGGTTTAAGGGG + Intronic
1024120301 7:46230025-46230047 GTGGAGAGAAGGACTTTATGTGG - Intergenic
1028379891 7:90188351-90188373 GCTAAGTGAAGGAGTTTACGAGG + Intronic
1028862973 7:95675402-95675424 GCAGAGTCAAGGAGCTTGAGTGG - Intergenic
1028884129 7:95912380-95912402 CTGGAGTGAAGGAGTTTATCTGG + Intronic
1038267718 8:26049196-26049218 GCATAGTGAAGGAGATTCAGCGG + Intergenic
1039382830 8:37101736-37101758 GGGGAGTGCAGGAGTTTCACAGG + Intergenic
1039539116 8:38348095-38348117 GCGGAGTCAATGAGTTGAGGTGG + Exonic
1040355748 8:46617042-46617064 GAGGAGGGAGGCAGTTTAAGGGG + Intergenic
1041168853 8:55119797-55119819 GTGGAGTGAAAGCATTTAAGTGG + Intronic
1047192231 8:122688637-122688659 GCGGGGTGAAGGATGTTATGGGG - Intergenic
1052218254 9:25991956-25991978 GGGTAATGAAGCAGTTTAAGTGG - Intergenic
1055706648 9:79012631-79012653 GTGAAATGAATGAGTTTAAGTGG + Intergenic
1187387566 X:18862393-18862415 GCAAAATGGAGGAGTTTAAGTGG + Intergenic
1188316313 X:28678143-28678165 GCCGGATGAAGGAGTTTGAGAGG + Intronic
1190143913 X:47873394-47873416 GCAGATTGAGGGAGTTTCAGGGG - Intronic
1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG + Intronic
1195666031 X:107432036-107432058 GGGGTGTGAAGGAGTGGAAGTGG + Intergenic
1196830609 X:119772778-119772800 GCAGAGTGAGGGAGGGTAAGTGG - Intergenic
1197119516 X:122873761-122873783 GCAGAGGGAAGGCCTTTAAGAGG - Intergenic