ID: 964838823

View in Genome Browser
Species Human (GRCh38)
Location 3:160971381-160971403
Sequence GGTCATCTGAGCATTTCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964838823_964838825 -3 Left 964838823 3:160971381-160971403 CCACTAGAAATGCTCAGATGACC 0: 1
1: 0
2: 1
3: 7
4: 126
Right 964838825 3:160971401-160971423 ACCACGTGGCCCTTAACTCCAGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964838823 Original CRISPR GGTCATCTGAGCATTTCTAG TGG (reversed) Intronic
906889868 1:49698384-49698406 AGTTTTCTGAGCATTTCTACAGG + Intronic
910718151 1:90255526-90255548 GGTCAAGTGTGCATTTCCAGAGG + Intergenic
912328100 1:108788046-108788068 TGTAATCTCAGCATTTCGAGAGG - Intronic
912364832 1:109124838-109124860 TGACCTCAGAGCATTTCTAGGGG + Intronic
915868256 1:159528830-159528852 GGACACCTGAGCATTTCTCCTGG - Intergenic
920018567 1:202935269-202935291 GGACATCTGAGAATTTCTTTGGG + Intergenic
920830326 1:209458873-209458895 GTTTATCTGTTCATTTCTAGAGG - Intergenic
922865099 1:228852873-228852895 TGTAATCTCAGCATTTCAAGAGG + Intergenic
1063029947 10:2224839-2224861 GGTCATCTCTGCATTTTGAGCGG - Intergenic
1067777293 10:49172815-49172837 GGGCATCTGCCAATTTCTAGGGG + Intronic
1069358623 10:67615918-67615940 TGTAATCTGAGCATTTTGAGAGG - Intronic
1070014175 10:72508723-72508745 GGTTTTCTGAGCATTTGTATAGG - Intronic
1072727271 10:97822242-97822264 GATCATTCTAGCATTTCTAGGGG + Intergenic
1073849535 10:107598886-107598908 GGTCACCTGAACATTTCTGGGGG - Intergenic
1081972882 11:47212139-47212161 GGTAATCTCAGCACTTCGAGAGG - Intergenic
1084496883 11:69510375-69510397 CCTCATCTGAGCATGTCCAGCGG + Intergenic
1084978598 11:72816553-72816575 GGGCATCTGTGCAGTTCTACAGG - Intronic
1091629535 12:2149232-2149254 ACTCATCTGAGCATTTCCACAGG - Intronic
1094598708 12:31889227-31889249 GGTGATCTGAGGATTTTCAGAGG - Intergenic
1097431108 12:59508408-59508430 TGTAATCTTAGCATTTCCAGAGG + Intergenic
1098170415 12:67741435-67741457 GGTCTCCTGAGCATTGTTAGTGG - Intergenic
1102957622 12:117069638-117069660 AGTCATCTGAGGACATCTAGGGG - Intronic
1103180621 12:118908161-118908183 GGTCAACTGGGCAGTTCTACTGG + Intergenic
1106115013 13:26810242-26810264 GGTCATATTTGCATTTCTAAAGG - Intergenic
1106200141 13:27529072-27529094 GGTCTTCTGGGCACTCCTAGAGG - Intergenic
1109912114 13:68927402-68927424 GGTAATCTCAGCATTTTCAGAGG + Intergenic
1110825933 13:79972283-79972305 GCTCCTTTGAGCATTTCTTGTGG + Intergenic
1113481301 13:110623744-110623766 CGTCATCTTAGCATTTTGAGAGG + Intronic
1114549499 14:23524856-23524878 GGTCATCATAGCACTTCTTGAGG + Exonic
1118437929 14:65788300-65788322 TGTAATCTGAGCACTTCTGGAGG - Intergenic
1119805003 14:77476791-77476813 TGTAATCTCAGCACTTCTAGAGG + Intronic
1122708365 14:103636531-103636553 TTTCATCTGAGCCATTCTAGCGG + Intronic
1124024455 15:25952187-25952209 TGTCATCTCAGCATTTTTGGAGG - Intergenic
1127356046 15:58201030-58201052 GGTCATCTGACCATTGCTTTTGG - Intronic
1128434943 15:67637538-67637560 TTTCTTCTGAGCCTTTCTAGTGG + Intronic
1128654658 15:69451894-69451916 GGTCATCTTTGCATTCCTCGTGG - Intergenic
1128827995 15:70738817-70738839 GGTCAACTGAGCAGTTCTGCTGG + Intronic
1132540402 16:505776-505798 GGTCATCTGAGCCTACCCAGTGG + Intronic
1135466663 16:22692504-22692526 TGACGTCTGAGCATTTATAGGGG - Intergenic
1135631649 16:24040076-24040098 GGAAATCTCAGCATCTCTAGAGG + Intronic
1138324532 16:56153129-56153151 GGTCATCTGAGCATTTAAGCAGG + Intergenic
1140219689 16:73034588-73034610 GGTGAAACGAGCATTTCTAGAGG + Intronic
1141402661 16:83764212-83764234 GGTGATCTGAGCATTTTTCTAGG + Intronic
1143273602 17:5693751-5693773 TGTAATCTCAGCATTTTTAGAGG - Intergenic
1143709431 17:8724137-8724159 GGTAATCCCAGCAGTTCTAGAGG - Intergenic
1144533479 17:16063480-16063502 GCTTATCTGAGTATTTCTATGGG + Intronic
1148050543 17:44768000-44768022 GCTCATCTGACCATTTTCAGTGG + Intronic
1149821163 17:59779020-59779042 AGTCTTCTGAGCATGTCTAAGGG + Intronic
1151366782 17:73622760-73622782 GGGCATCTGAGCATTGCTCTTGG - Intronic
1153419411 18:4887173-4887195 GATCATCTGAGCTTGTTTAGGGG - Intergenic
1154365606 18:13705864-13705886 GGTCATTTAAACATTTGTAGAGG + Intronic
1158202932 18:54959912-54959934 GGTAATCTCAGCATTTTGAGAGG + Intergenic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1166014940 19:39972494-39972516 GGTCATCGGACAATTTCTGGAGG + Exonic
1166581074 19:43900403-43900425 GGTCATCTGAATTTCTCTAGTGG + Intronic
1166915461 19:46192773-46192795 AGTCATCCCAGCCTTTCTAGTGG + Intergenic
1167522788 19:49965989-49966011 TGTCATCTCAGCATTTTGAGAGG - Intergenic
930854607 2:56000130-56000152 GTACATCTGAGCAATTCTATTGG + Intergenic
933736101 2:85495687-85495709 GGCCATTTGAACATTTATAGAGG + Intergenic
934045392 2:88169388-88169410 GGGCATTTGGGCATATCTAGAGG + Intergenic
939957580 2:148539770-148539792 GATCACCTGAGCATTTTCAGAGG - Intergenic
941633917 2:167914957-167914979 GGGCTGCTGAGCATTGCTAGGGG - Intergenic
943495610 2:188617069-188617091 TGTAATCTCAGCATTTCTGGAGG - Intergenic
943743919 2:191441325-191441347 GGTAATCTCAGCATTTTGAGAGG - Intergenic
944917173 2:204372982-204373004 TGTAATCTGAGCATTTTGAGAGG + Intergenic
945364469 2:208934578-208934600 GGTTATCTGAAAATTTTTAGGGG - Intergenic
946294823 2:218775688-218775710 GGTGACCTGAGCATCTCTGGGGG - Intergenic
947400851 2:229730307-229730329 GGTCATTGGAGCTTTTCTATAGG - Intergenic
948994361 2:241571056-241571078 GGTCACCTGAGCACTCCTGGGGG + Intronic
1175608975 20:60334445-60334467 TGTCAGCTGGGCACTTCTAGGGG - Intergenic
1175628347 20:60509500-60509522 GGTCATTTAAGCATCTATAGGGG - Intergenic
1176989134 21:15473215-15473237 GGACATTTGGGAATTTCTAGAGG - Intergenic
1179949796 21:44703247-44703269 CGTCATGGGAGCATTTCCAGTGG + Intronic
1180171468 21:46060899-46060921 GGTCCTCTGGGGATTTCCAGTGG + Intergenic
1183167339 22:36157712-36157734 GTTGATTTGAGCATTTCTTGTGG - Intronic
949106665 3:207759-207781 GCTCCTCTGAGAATTGCTAGAGG - Intronic
949386082 3:3503865-3503887 GGGAGTCTGAGCTTTTCTAGGGG - Intergenic
951107361 3:18760674-18760696 GGTCATCTCAGCATTTCTACTGG - Intergenic
954823624 3:53352200-53352222 GGGCATCAGAGCATGTTTAGAGG - Intergenic
955738602 3:62065769-62065791 GGTCATCTTATCATTTCTGGTGG - Intronic
963998719 3:151741485-151741507 GGACATCTGATGATCTCTAGAGG + Intronic
964838823 3:160971381-160971403 GGTCATCTGAGCATTTCTAGTGG - Intronic
968282557 3:197488120-197488142 GGTGACCTGAGCATTACCAGAGG + Intergenic
970126686 4:12821417-12821439 GGTCATTTGAACATTAATAGAGG + Intergenic
971765600 4:30826666-30826688 TGTCATCTGAGGAGTCCTAGGGG + Intronic
972176577 4:36415085-36415107 GATCATCTCATCAGTTCTAGAGG + Intergenic
973968494 4:56187541-56187563 GATCATCTTAGTACTTCTAGGGG + Intronic
980857362 4:138455554-138455576 TGTCATCTCAGAATTTCTAACGG - Intergenic
983465261 4:168080035-168080057 GGTCATCTTTGCAAGTCTAGTGG - Intergenic
989089872 5:37719147-37719169 GGCCATCTGGGAATTTCCAGTGG + Intronic
989411008 5:41120465-41120487 TGTCATCCCAGCATTTTTAGAGG + Intergenic
993004189 5:82412933-82412955 GGACAGCTCAGCACTTCTAGCGG - Intergenic
994838621 5:104891422-104891444 GTCTATCTGAGCATTTCTAAGGG - Intergenic
995501095 5:112807896-112807918 TGTAATCTCAGCATTTCCAGAGG + Intronic
1001312299 5:170619860-170619882 AGTGATCTGAGGATTTCTAAAGG - Intronic
1003676324 6:8207757-8207779 TGTCAGCTGATCATTTCTAGGGG + Intergenic
1006070917 6:31497581-31497603 TGTGATCTGAGCGTTTCTACTGG + Intronic
1008265696 6:49423162-49423184 GGTCATCAGAGCAATATTAGTGG - Intergenic
1008840772 6:55900697-55900719 GGTCCTCTGAGCCCTTCCAGTGG + Intergenic
1011753561 6:90476753-90476775 GGTCTTCTGAGCGTTTGAAGGGG + Intergenic
1012876063 6:104728054-104728076 TGTAATCTCAGCATTTCGAGAGG - Intergenic
1014931754 6:127344178-127344200 GATCATCTGGGCATTTTTAAAGG + Intergenic
1016061849 6:139638666-139638688 GGTTATCAGAGCATTTCTCAAGG - Intergenic
1017247458 6:152241755-152241777 AGTCAGCTCTGCATTTCTAGAGG + Intronic
1018649795 6:165983958-165983980 GCACATCTGTGCATTTCTGGTGG - Intronic
1018724116 6:166597408-166597430 GGCCATTTGAGCATCTCTACAGG + Intronic
1019660332 7:2220388-2220410 GGTTTTCTGAGCTTTTCCAGAGG - Intronic
1021193671 7:17650571-17650593 GGTCATATGACCATTACAAGAGG - Intergenic
1021411374 7:20332033-20332055 GGTCATCAGAGAACTTCAAGGGG + Intronic
1022862282 7:34379969-34379991 GGCCATTTGAACATTTCTAGAGG - Intergenic
1023152169 7:37212489-37212511 TGTCATCTTACCACTTCTAGTGG - Intronic
1026396692 7:69962369-69962391 TATCATCTGAGCATTTCAGGAGG - Intronic
1026620570 7:71946616-71946638 TGTAATCTGAGCATTTTTAGAGG - Intronic
1028855908 7:95593715-95593737 GGTCATCTGGGCTTTTCTCATGG + Exonic
1031761965 7:125724484-125724506 TGTCATGTCAGCATTTCAAGAGG + Intergenic
1032455765 7:132072415-132072437 GGTGATCTGTGTATTTCTAAAGG + Intergenic
1032634772 7:133694397-133694419 CATCTTCTGAGCATTTATAGCGG - Intronic
1039942302 8:42101710-42101732 GGTCATCTCAGAATGTCAAGAGG - Intergenic
1042382055 8:68128434-68128456 TGTCATCTGGCCATTTCTGGTGG + Intronic
1043731150 8:83683926-83683948 TGACATGTGAGCATTTCAAGGGG - Intergenic
1045495226 8:102702475-102702497 CCTCATCTGAGCCTTTCCAGAGG + Intergenic
1048580121 8:135723747-135723769 GGTCATCTGATCTTTCCTAATGG + Intergenic
1053492446 9:38519012-38519034 CTTCATCTCAGCCTTTCTAGTGG - Intergenic
1059181259 9:112214658-112214680 TGTTATCTCAGCATTTCAAGAGG + Intergenic
1060146381 9:121256086-121256108 GGTCAAATGAGCCTTTTTAGAGG + Intronic
1060201813 9:121655759-121655781 TTTCATCTGAGTTTTTCTAGGGG + Intronic
1060721412 9:125982002-125982024 ACACATCTGAACATTTCTAGAGG + Intergenic
1194485042 X:94476227-94476249 GATCATATGAGTATTTCTAGGGG + Intergenic
1195071256 X:101282524-101282546 TCTCTTCTGTGCATTTCTAGTGG - Intronic
1195421758 X:104683397-104683419 TGTCTTCTGTGCATTCCTAGGGG + Intronic
1195471919 X:105239970-105239992 GGTCATTTAAACATTTATAGAGG - Intronic
1197461095 X:126742259-126742281 GGGCAACTGAGCATTTGGAGTGG - Intergenic
1198202877 X:134439443-134439465 TGTAATCTGAGCACTTCTGGAGG - Intergenic
1199061756 X:143363866-143363888 GGGCATGTGAGTATTTCTAGTGG - Intergenic
1199145510 X:144361521-144361543 GGTTATTTGAGCATTTTTAAGGG - Intergenic