ID: 964838853

View in Genome Browser
Species Human (GRCh38)
Location 3:160971720-160971742
Sequence GGCAAGAATTGGTCTGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964838853_964838861 25 Left 964838853 3:160971720-160971742 CCTTATACAGACCAATTCTTGCC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 964838861 3:160971768-160971790 TTCTTTTTTTTATTGAGACAGGG 0: 6
1: 370
2: 15622
3: 26731
4: 66021
964838853_964838860 24 Left 964838853 3:160971720-160971742 CCTTATACAGACCAATTCTTGCC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 964838860 3:160971767-160971789 ATTCTTTTTTTTATTGAGACAGG 0: 1
1: 36
2: 1086
3: 19520
4: 35320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964838853 Original CRISPR GGCAAGAATTGGTCTGTATA AGG (reversed) Intronic
918354734 1:183696850-183696872 GGCAAGAATTGGTCAGATTCTGG - Intronic
1063265704 10:4448031-4448053 AGCCAGAATTGGTCTGGATTTGG + Intergenic
1063464792 10:6236111-6236133 GGCAAGAACTGGTGTTTAAAAGG - Intergenic
1063925899 10:10977068-10977090 GTCAAGAATTGGTCTAAATCAGG - Intergenic
1064510139 10:16081192-16081214 CGCAAGAATTTGTCTTTATGTGG - Intergenic
1080794719 11:35552779-35552801 GGCAAGAATTGGGGTGTGGAGGG + Intergenic
1085255375 11:75169601-75169623 GGCAAGCACTGGTCTGCAGAGGG + Intronic
1089407350 11:118209286-118209308 GGTAAGATTTGGTCTGAATAAGG - Intronic
1093744453 12:22723695-22723717 GACAAGAATTGGTTTGTTTGAGG + Intergenic
1095690531 12:45083526-45083548 GACAAGAACTGGTGTCTATAGGG - Intergenic
1104230490 12:126879493-126879515 GGGAAAAATTGGTCTGCAAAAGG - Intergenic
1126499895 15:49334395-49334417 GGAATGAATTGGTTTGTAGAGGG - Intronic
1126527421 15:49672088-49672110 GGAAGGCATTGGTCTGTGTAAGG + Intergenic
1135159671 16:20082724-20082746 GGGAAGAATTCCTCTGTAAAGGG - Intergenic
1138667639 16:58585745-58585767 GGTACGAATTGGTCAGTAGATGG - Intronic
1141432900 16:83980175-83980197 GGCTAGAGATGGTCTGGATAAGG - Intronic
1146253976 17:31378244-31378266 GGCAAGTACTTGTCTGTTTATGG + Intronic
1146966017 17:37030518-37030540 GGTATGATTTGGTCTGTATAAGG + Intronic
1156176028 18:34547384-34547406 AGCAAGAATTGATCTTTCTACGG + Intronic
1156657649 18:39308108-39308130 GGGAAGAAATGGCCTGTATCAGG - Intergenic
1158027019 18:52911978-52912000 GGCATGAAAAGGTCTGCATATGG + Intronic
1167180011 19:47895864-47895886 GGCCCGATTTGGTTTGTATATGG + Intergenic
926581522 2:14635293-14635315 GGCGAGAACTGGTCTCTACAGGG + Exonic
928143992 2:28754838-28754860 GGCAAGAATTTCTCTGCATTAGG + Intronic
933081120 2:77988067-77988089 GGCAACCATTGATCTGTATATGG - Intergenic
939642073 2:144652748-144652770 GGGAAGACTGGGTCTCTATAGGG + Intergenic
941422980 2:165306071-165306093 GGAAAGAATTGGTCTCAATGTGG + Intronic
941474607 2:165934768-165934790 GGCCAGAATTGGTGAGGATAAGG + Intronic
942014098 2:171793626-171793648 GGGAATTTTTGGTCTGTATAAGG - Exonic
944182723 2:196913005-196913027 GGCAATAATTGGTCATTCTATGG - Exonic
945013887 2:205494058-205494080 GTTAAGAAATGGTCTTTATAAGG - Intronic
953586818 3:44208826-44208848 GGTAAGTATTGGTGAGTATATGG + Intergenic
959298338 3:104567076-104567098 GACAATAATTTGTCTCTATATGG + Intergenic
959484490 3:106911023-106911045 GGTAATAATTGGTCTGGGTAAGG - Intergenic
964838853 3:160971720-160971742 GGCAAGAATTGGTCTGTATAAGG - Intronic
967881288 3:194303530-194303552 GGCAAGAAGGGGTCTGTGTGTGG + Intergenic
969962356 4:10958212-10958234 CTCAAGTATTGTTCTGTATAAGG - Intergenic
979821036 4:125172224-125172246 GGTAAGAATTTGTGTGCATAGGG + Intergenic
981364013 4:143880241-143880263 GGCAAGAATTCCTCTGTAGTAGG + Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
996005908 5:118420270-118420292 GGCAGGAATACTTCTGTATAAGG - Intergenic
998591604 5:143485054-143485076 GGCAAGAATCAGTCAGAATATGG + Intergenic
1002356433 5:178633026-178633048 GGCAAGAATTATTATGAATAAGG - Intergenic
1003289696 6:4769415-4769437 GCCAAGTATTGGTCTGAATACGG + Intronic
1008946132 6:57098948-57098970 GGCAAGAATTACTCTGAAGAGGG - Intronic
1010276108 6:73970421-73970443 GGGAAGAAAAGGTCAGTATAGGG - Intergenic
1011795251 6:90945989-90946011 GGCTAGAATTGGTCAGTGTCTGG + Intergenic
1013706742 6:112844312-112844334 GGCAAGTATTGGTCTCTAAGAGG - Intergenic
1014173052 6:118300155-118300177 GAAAAAAAATGGTCTGTATAAGG - Intronic
1015579492 6:134708032-134708054 GGCAAGGATGGGTTTGTATCTGG - Intergenic
1016915058 6:149237118-149237140 GGCAAGAAATAATATGTATAAGG + Intronic
1020352211 7:7233377-7233399 GGGAAGAATTGGTAAGAATAAGG - Intronic
1022412752 7:30151968-30151990 GGCAAGAATTGGACTTTTTCTGG - Intronic
1027908062 7:84211831-84211853 GACAAAAATTGGTCTATATGTGG + Intronic
1033157970 7:138972463-138972485 GGCAAGAGGTGGTCTGGATGAGG - Intronic
1036632718 8:10526409-10526431 GGCAAGAAGTGGTGTGCACAGGG - Intronic
1039042730 8:33423558-33423580 TGCAAGAATTGGTCTGGAAATGG - Intronic
1039310111 8:36308402-36308424 GGCAAGGATTAGTCTGTTTTAGG - Intergenic
1041721676 8:60981794-60981816 GGCAAGACTTGGTGTTTGTAAGG + Intergenic
1041946583 8:63450431-63450453 GGAAAGAATAGGTCTGAACATGG - Intergenic
1047410216 8:124618294-124618316 GGGAAAAATTGGTATGTAGAGGG - Intronic
1058812477 9:108654481-108654503 GCCAAGAATTGGTATGAGTATGG - Intergenic
1186003786 X:5044968-5044990 AGCAAGAAAGGGTCTGTAGAGGG - Intergenic