ID: 964847990

View in Genome Browser
Species Human (GRCh38)
Location 3:161064453-161064475
Sequence GAATATGACCTTAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 154}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964847988_964847990 8 Left 964847988 3:161064422-161064444 CCATTTAGATACAGTTGACATTC 0: 1
1: 0
2: 1
3: 14
4: 220
Right 964847990 3:161064453-161064475 GAATATGACCTTAATGAGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 154
964847987_964847990 25 Left 964847987 3:161064405-161064427 CCATGAAAACTAAAGAGCCATTT 0: 1
1: 0
2: 3
3: 27
4: 335
Right 964847990 3:161064453-161064475 GAATATGACCTTAATGAGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964847990 Original CRISPR GAATATGACCTTAATGAGGA AGG Intronic
900489012 1:2937043-2937065 GAATCGGACCTTTATGAGCACGG + Intergenic
905036384 1:34920818-34920840 GAATATAAACTTCATGAGCATGG - Intronic
905571034 1:39005681-39005703 GAATATTACCTTACTTTGGAAGG - Exonic
908054572 1:60269596-60269618 GAATATTTCCTTAAAGAGAATGG + Intergenic
912218920 1:107649854-107649876 AAATATGAGCTTTATGAGGGAGG - Intronic
913427580 1:118751186-118751208 GAAAATGACAATAAGGAGGATGG + Intergenic
916326558 1:163566866-163566888 GATTATGACCTTAATGAAAAAGG - Intergenic
916517917 1:165537355-165537377 GAAGAAAACCTTTATGAGGAAGG + Intergenic
918102597 1:181389500-181389522 GAATCTGCAATTAATGAGGATGG + Intergenic
918220775 1:182434431-182434453 CCATATTACCTTAATGAGCAGGG - Intergenic
919425603 1:197426492-197426514 GAATGTAAGCTTGATGAGGATGG + Intronic
920195269 1:204222488-204222510 GACTTGGACATTAATGAGGATGG + Exonic
920554426 1:206894239-206894261 GAACATGACCTTATTGGGAAAGG - Intergenic
920841715 1:209560952-209560974 GAAAATAATGTTAATGAGGAGGG + Intergenic
1064270319 10:13859473-13859495 GAATATAAGCTCCATGAGGATGG - Intronic
1066600130 10:37095908-37095930 GAATATGTGCTTAATAAGGAAGG + Intergenic
1069500759 10:68950930-68950952 GGAAATAACCTGAATGAGGAGGG + Intergenic
1070087775 10:73253293-73253315 GAATATGACCTCGGTGATGAGGG + Intergenic
1071164958 10:82795247-82795269 GTATATAACCTTAATGAGTCTGG + Intronic
1072002772 10:91213923-91213945 GAATATGACCTTATTTGGAAAGG + Intronic
1076941684 10:133614394-133614416 GAAAATGATCATGATGAGGATGG - Intergenic
1078323659 11:10359889-10359911 TAATATGAACATAATAAGGAAGG + Intronic
1078519611 11:12052656-12052678 AAATATGAGCTCCATGAGGAAGG - Intergenic
1082909066 11:58349342-58349364 GAATATGTCCCCAATGCGGAGGG + Intergenic
1085890257 11:80570984-80571006 GAATATGTGCTTAATAAGGAAGG - Intergenic
1086332253 11:85765773-85765795 GAATATGAGATTAAGGAGTAGGG - Intronic
1087825898 11:102764432-102764454 GAATATAACCTGAATGAGCTTGG - Intergenic
1087912312 11:103768167-103768189 AACTATGTGCTTAATGAGGAAGG - Intergenic
1091493478 12:952500-952522 GAATGTGACCTTAATTAGAGAGG + Intronic
1092504355 12:9080839-9080861 TAATATGAATTTTATGAGGAAGG - Intronic
1093237035 12:16622336-16622358 GAATATGCACTTAAGGAGGCTGG + Intergenic
1093315389 12:17643832-17643854 GAACATGACCTGAAGGATGAAGG + Intergenic
1093679840 12:21989377-21989399 TATTATGACCCTAATGAGGTAGG - Intergenic
1093795697 12:23307845-23307867 AAATACCACCATAATGAGGAGGG - Intergenic
1097586038 12:61517378-61517400 GAATATCACTTGAATGATGATGG + Intergenic
1099274670 12:80559694-80559716 GAATATTACCTTACTTTGGAAGG + Intronic
1103627308 12:122229687-122229709 GAGTATGCCCTTACTGAGAAAGG - Exonic
1104102068 12:125622125-125622147 GGAGGTGACCTAAATGAGGAAGG - Intronic
1104183398 12:126404619-126404641 AAATATGCCCTAAATCAGGAAGG - Intergenic
1104887390 12:132118668-132118690 GAATAAGGCCTTAGCGAGGAAGG - Intronic
1105553581 13:21423169-21423191 GAATATGACCATTAAGATGATGG - Intronic
1105864935 13:24451125-24451147 GAATAGGCCCTCACTGAGGAAGG + Intronic
1107847969 13:44538480-44538502 GAAAATCACCTTAATGAAGTAGG - Intronic
1110268001 13:73560266-73560288 GAATATTTCCTTCATGGGGAGGG + Intergenic
1111046292 13:82817557-82817579 GAAAATGACATTAATAAGAAGGG - Intergenic
1113012020 13:105779074-105779096 GAATGTAACCTTCATGAGGGTGG - Intergenic
1113860273 13:113479033-113479055 GAAAATCACCTTCATGATGATGG + Intronic
1116620847 14:47201269-47201291 GAATATGGAGTTAGTGAGGATGG - Intronic
1118496607 14:66313841-66313863 GAATGTGACCTTATTTAGGCAGG - Intergenic
1120502001 14:85308811-85308833 GAATCTTACCTTAAAGGGGAAGG - Intergenic
1126928633 15:53621486-53621508 GAATATGACCTGGATGAGATTGG + Intronic
1128514010 15:68331029-68331051 CAATTGGACCTCAATGAGGATGG - Exonic
1129987342 15:79929724-79929746 GAATGTGAACTTCATGAGAACGG + Intergenic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137706870 16:50541588-50541610 GAATATAAACTTCATGAGGATGG + Intergenic
1138601189 16:58055630-58055652 GAATGTGACCTCAGTAAGGAGGG - Intergenic
1146307716 17:31743421-31743443 GAGGTTGACCTTAATGAAGAAGG + Intergenic
1146567960 17:33929408-33929430 GAAAATTACCTAAATGAGGTTGG - Intronic
1151263933 17:72939162-72939184 GAATATGACCTTACCTAGGCAGG + Intronic
1155251696 18:23959174-23959196 GAATATAACCTTTATGTGTAAGG - Intergenic
1155848439 18:30738742-30738764 CAATTTGACCTTAATGTGGTTGG + Intergenic
1156221098 18:35053075-35053097 TAATATGTACTTACTGAGGATGG - Intronic
1157486166 18:48088928-48088950 GAATTTGACCTTAATTTGGTAGG + Intronic
1159932104 18:74323745-74323767 CAATATAACATTAATGAGAAAGG + Intronic
1163764524 19:19155383-19155405 GAATCTGACCTAGAGGAGGATGG - Intronic
1165175961 19:33930021-33930043 GAATGTAAGCTTCATGAGGACGG - Intergenic
925634000 2:5924837-5924859 AACTATGACCATAGTGAGGAAGG + Intergenic
925861243 2:8178335-8178357 AAATATGACCATTATGAGGAGGG + Intergenic
932212607 2:69945013-69945035 CACTATGACCTAGATGAGGAGGG + Intergenic
932502567 2:72196756-72196778 GAAAATGAACTTAATGACAAAGG - Intronic
936430287 2:112456770-112456792 AAATACGCACTTAATGAGGATGG + Intergenic
939309232 2:140452125-140452147 GCATATCACTTTTATGAGGAAGG + Intronic
939674481 2:145054925-145054947 GAATATGACATTAATGTCGGAGG + Intergenic
941032914 2:160533338-160533360 AAAGGTGACCTTGATGAGGAAGG + Intergenic
942129342 2:172862995-172863017 GAATATGACCTGAGACAGGATGG + Intronic
942535920 2:176963922-176963944 GAATATGAAGTGACTGAGGAAGG + Intergenic
943446891 2:187997023-187997045 GAATATAACTTTAATGATTATGG - Intergenic
945655680 2:212620260-212620282 GAATATGAACTAATTGATGAGGG + Intergenic
945889104 2:215409583-215409605 GAATATGAGCTGAGTGAGGAGGG - Exonic
948577558 2:238964506-238964528 GAATGTGACCATACTGGGGAAGG + Intergenic
1169705596 20:8500847-8500869 TAATATGAGATTTATGAGGAAGG + Intronic
1171948795 20:31402506-31402528 GAATATGAAGTTATTGAGTAGGG + Intergenic
1173273785 20:41560361-41560383 GAATAAGACCTGAATGAGCAGGG - Intronic
1177621711 21:23603951-23603973 GAAGACGACCTTCATTAGGAAGG - Intergenic
1178088073 21:29132983-29133005 TTATATGACCTTAAAGAGGCAGG + Intronic
1183068951 22:35382984-35383006 GAACGTGGCCTGAATGAGGATGG + Intronic
949306604 3:2648753-2648775 GGAATTGACCTTAATGAGGAAGG + Intronic
951284824 3:20797315-20797337 AAATATGGCCATAATGAGAAAGG - Intergenic
952882465 3:37993554-37993576 GAACATGACTTTTATTAGGAGGG - Intronic
954886253 3:53876629-53876651 GAATATGATACTAATGAAGATGG - Exonic
956068998 3:65427838-65427860 GATTATGACAATAATGATGATGG - Intronic
956223181 3:66925477-66925499 GAAAAGGACATTAATGAGCAAGG + Intergenic
958126805 3:89366777-89366799 GAATATAAGCCTAATGAGGGTGG + Intronic
960114115 3:113876182-113876204 GAATATAACCTTCATGACCAAGG + Exonic
960638773 3:119808598-119808620 GAATAGTACCCAAATGAGGAAGG - Intronic
961943363 3:130659812-130659834 ATAAATGACCTAAATGAGGAAGG + Intronic
964847990 3:161064453-161064475 GAATATGACCTTAATGAGGAAGG + Intronic
964876870 3:161377221-161377243 GAATATTGCCTTAAAAAGGAAGG - Intergenic
965106778 3:164366288-164366310 GGTTATGACTGTAATGAGGAAGG - Intergenic
967813175 3:193777465-193777487 GAATATGACCTGAATCAGCTAGG - Intergenic
968014520 3:195317370-195317392 GAATATGAATTTAATGATGAAGG - Intronic
972188512 4:36562472-36562494 GAGTCTCACCTTAATGCGGATGG + Intergenic
972459447 4:39287111-39287133 AAATATGCCCTTTATGAGGATGG - Intergenic
976233252 4:82868200-82868222 GAAAATGACCTACATGAGGCTGG + Intronic
978493065 4:109329485-109329507 GAATATGACCTTAAGGGGAATGG + Intergenic
979537075 4:121834658-121834680 GAACATGAGCTTAAAGAGAAGGG - Intronic
979870817 4:125819071-125819093 GACTATGACCCTATTTAGGAAGG + Intergenic
981048048 4:140283671-140283693 GTATATGACCTTCATGTGAAAGG + Intronic
981464246 4:145049198-145049220 GTATCTCACCTTAATGATGACGG + Intronic
981854291 4:149269063-149269085 GAACATGACCTTAATCACAAAGG + Intergenic
981902015 4:149877385-149877407 TATTATGACCTGAATTAGGAAGG - Intergenic
983654555 4:170069581-170069603 GAACAAGACCATAATGAGGATGG + Intronic
984581393 4:181514324-181514346 CAATATGATGTTAATGAGGTAGG - Intergenic
987919964 5:24266967-24266989 GATTATAAACTTAGTGAGGATGG + Intergenic
988938770 5:36119444-36119466 GAATCTGAGCTGCATGAGGAAGG - Intronic
993444496 5:87994687-87994709 GAAAATGACCTTAATGCCCAAGG + Intergenic
994818293 5:104613165-104613187 AAAAATGACATTAATGAGGAAGG - Intergenic
994953953 5:106502699-106502721 GAATGTGACCTTCATGAATATGG + Intergenic
995342604 5:111076076-111076098 AAATATGACCATAATAAAGATGG - Exonic
997594625 5:135098397-135098419 AAATATGATCTTAATGAATATGG - Intronic
998306963 5:141087943-141087965 GAAAATATCCTGAATGAGGATGG + Intergenic
999512346 5:152265664-152265686 GAATATGATCTTTACGAGGGTGG - Intergenic
999619942 5:153462663-153462685 GAATAAGACCTAATTGTGGAGGG + Intergenic
1000095371 5:157966831-157966853 GAATATGACCCTATTTAGAAAGG + Intergenic
1001754863 5:174160450-174160472 GACTCTGACCTCCATGAGGAAGG + Intronic
1002207628 5:177574567-177574589 GACAATGACAATAATGAGGATGG + Intergenic
1004233851 6:13855929-13855951 GCATATGACCTTAATACGTATGG + Intergenic
1007691080 6:43701831-43701853 GAATATAACCTTAAAAAGGAAGG - Intergenic
1008404656 6:51105361-51105383 GGATGTGATCTTAATGAGAAAGG - Intergenic
1009028355 6:58026922-58026944 TAATATCACCTTATTGAAGAAGG + Intergenic
1009203890 6:60778306-60778328 TAATATCACCTTAGTGAAGAAGG + Intergenic
1009281085 6:61752706-61752728 GAATATGACCTCAATGAGCATGG - Intronic
1010559257 6:77327372-77327394 GAATTTGACCTTGAAGAAGATGG + Intergenic
1012424898 6:99103078-99103100 AAATGTTACCTTAATGAGAAAGG + Intergenic
1012640987 6:101613363-101613385 GAATATGACCTAAAGGCAGAAGG + Intronic
1013569342 6:111405563-111405585 GAATATGCGCTTCATGAGGCTGG + Exonic
1014609312 6:123521595-123521617 TAATATTACCTTATTGAGGCTGG - Intronic
1014685913 6:124500091-124500113 TAATATGCCAATAATGAGGAGGG - Intronic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1020173206 7:5861672-5861694 GAAAATGTCCAAAATGAGGAGGG - Intergenic
1020503830 7:8958017-8958039 GAATATGACTTTAATACTGAGGG - Intergenic
1020969987 7:14924035-14924057 GAATATGACCTGAAGGCAGAAGG + Intronic
1022153917 7:27640111-27640133 GAATATGACAATAATAAGGGAGG - Intronic
1026376115 7:69752744-69752766 AAATATGACTTTTAGGAGGAAGG + Intronic
1029085539 7:98008861-98008883 GAAAATGTCCAAAATGAGGAGGG + Intergenic
1031867080 7:127049606-127049628 GGCTATAAGCTTAATGAGGATGG - Intronic
1032064338 7:128754383-128754405 GGGCATGACCTCAATGAGGACGG + Intronic
1041115703 8:54534193-54534215 GCATATAACTTTAAAGAGGAAGG - Intergenic
1041798312 8:61770462-61770484 GAATATAAATTTCATGAGGATGG - Intergenic
1041885095 8:62799141-62799163 GAATATGAACATAGTGAGGAGGG + Intronic
1043004757 8:74805330-74805352 GAACATGACAGTAATGAAGAAGG + Intronic
1044388906 8:91625439-91625461 GAATATGAGATAAATGCGGATGG - Intergenic
1045827388 8:106414829-106414851 GAGTATGGACTTAATTAGGAAGG + Intronic
1047311818 8:123698404-123698426 GCACAGGACCTCAATGAGGACGG + Exonic
1047825877 8:128574547-128574569 TAATATGCCCTTGATGTGGAAGG + Intergenic
1048985590 8:139733081-139733103 GAATGTGACCGTATTGGGGAAGG + Intronic
1050567248 9:6899019-6899041 TAATATGAACTTAGTGAGTATGG + Intronic
1050885918 9:10764605-10764627 GAATAAGACCTGAGTGAGGTTGG + Intergenic
1051712958 9:19950684-19950706 GAATATGAACTTCATGAGGGGGG - Intergenic
1052746981 9:32450513-32450535 GAAAATGACCCTCAAGAGGAAGG - Exonic
1055272835 9:74581022-74581044 GAATAAGCCCTTAATGTAGAGGG - Intronic
1055789250 9:79904107-79904129 GGCTAAGACTTTAATGAGGAAGG - Intergenic
1057836027 9:98445988-98446010 GAAAGTTACCTTAATGTGGAAGG - Intronic
1058750360 9:108033257-108033279 TCAGATGACTTTAATGAGGATGG - Intergenic
1059514873 9:114883699-114883721 GAATATTACCTTACTTTGGAAGG - Intergenic
1062425144 9:136502616-136502638 GAAAATGACCTTATTTTGGAGGG - Intronic
1186631219 X:11351020-11351042 GAATATGACCTAAAGGATGGGGG - Intronic
1192992706 X:76478061-76478083 GAAAATCACCTTCATGAGGCAGG - Intergenic
1196568932 X:117243128-117243150 AAATATGACCTTATGGAGAAAGG + Intergenic
1198145322 X:133850668-133850690 GAAGTTGCCATTAATGAGGAAGG - Intronic
1198702734 X:139415151-139415173 TAATATTACATTAATTAGGATGG + Intergenic
1199434949 X:147802700-147802722 GAAAGTGACAGTAATGAGGAAGG - Intergenic