ID: 964848785

View in Genome Browser
Species Human (GRCh38)
Location 3:161071595-161071617
Sequence ATCTACAAGCCATAGTAGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964848785_964848790 0 Left 964848785 3:161071595-161071617 CCCCCCTACTATGGCTTGTAGAT 0: 1
1: 0
2: 0
3: 5
4: 182
Right 964848790 3:161071618-161071640 TTTCAAAAGATAGAAGTTCTAGG 0: 1
1: 0
2: 3
3: 52
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964848785 Original CRISPR ATCTACAAGCCATAGTAGGG GGG (reversed) Exonic
909261099 1:73490475-73490497 CTCTACAAGCCAGAGGAGAGGGG - Intergenic
910027641 1:82677198-82677220 ATCTAGAAGCCATTTTGGGGGGG + Intergenic
913468080 1:119163662-119163684 ATCTACAAGCCAAATGAGAGAGG + Intergenic
913719382 1:121576087-121576109 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
915795090 1:158722389-158722411 ATTTACAAGCCAGAGAAGTGAGG - Intergenic
917500505 1:175580800-175580822 ATCTACATGCCATAAAATGGTGG - Intronic
917723165 1:177805459-177805481 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
921243887 1:213215690-213215712 TTCTACAAGCCAGAATAGAGTGG + Intronic
1064883846 10:20087262-20087284 CTCTGCAAGCCAGAGTATGGAGG - Intronic
1066724536 10:38376958-38376980 CTCTACAAGCCAGAAGAGGGTGG - Intergenic
1068576079 10:58686194-58686216 CTCTACAAGCCAGAATAGAGTGG - Intronic
1069188844 10:65462756-65462778 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1070848843 10:79546256-79546278 ATCTACAGGCCAGAGTCCGGAGG - Intergenic
1071763228 10:88632935-88632957 CTCTACAAGCCAGAAGAGGGTGG - Intergenic
1072774895 10:98181350-98181372 ATCTACAAGCCAGAAGAGAGTGG - Intronic
1072900513 10:99402833-99402855 ATCCACATGCCATAATAGGCAGG - Intronic
1074652013 10:115534937-115534959 CTCTACAAGCCAGAATAGAGTGG - Intronic
1078951868 11:16143163-16143185 CTCTACAAGCCAGAATAGAGTGG + Intronic
1079516350 11:21273715-21273737 CTCTACAAGCCAGAGGAGAGTGG + Intronic
1081551874 11:44121126-44121148 ATGTTCAAGCCCTAGTGGGGTGG + Intronic
1081551986 11:44121931-44121953 ATGTTCAAGCCCTAGTGGGGTGG - Intronic
1083076658 11:60046803-60046825 ATCTAGAAGGCATAGTATGCTGG + Intronic
1084485663 11:69446681-69446703 ATCTACAGGCCAGAGAAGGGAGG - Intergenic
1086093191 11:83024341-83024363 ATCTACATGCCAAAATAGTGAGG + Intronic
1086175455 11:83885760-83885782 CTCTACAAGCCAGAATAGAGTGG + Intronic
1090895929 11:130975413-130975435 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
1091867435 12:3852945-3852967 CTCTACAAGCCAGAAGAGGGTGG + Intronic
1092034961 12:5326091-5326113 ATCTACATGACATAGGAGCGAGG - Intergenic
1094263086 12:28523904-28523926 CTCTACAAGCCAGAATAGAGTGG - Intronic
1095387711 12:41670635-41670657 CTCTACAAGCCAGAATAGAGAGG - Intergenic
1097569815 12:61318518-61318540 CTCTACAAGCCAGAGGAGAGTGG + Intergenic
1097800672 12:63910652-63910674 ATCTATAAGACATGGTAGGGAGG + Intronic
1098699608 12:73607495-73607517 CTCTACAAGCCAGAGGAGAGTGG + Intergenic
1103203449 12:119109151-119109173 CTCTACAAGCCAGAAGAGGGTGG - Intronic
1103450073 12:121022514-121022536 ATATAAAAGCCATTGTAGGCTGG - Intronic
1107558397 13:41539074-41539096 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1112482565 13:99790531-99790553 CTCTACAAGCCAGAATAGAGTGG - Intronic
1112663639 13:101543387-101543409 CTCTACAAGCCAGAAGAGGGTGG - Intronic
1117529106 14:56641327-56641349 CTCTACAAGCCAGAAGAGGGTGG + Intronic
1118814183 14:69298327-69298349 ATCTACAAGCTGAAGGAGGGAGG - Intronic
1123790626 15:23715747-23715769 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
1130572114 15:85056138-85056160 CTCTACAAGCCAGAAGAGGGTGG - Intronic
1130644607 15:85713207-85713229 ATCTAAAAGCCAGCATAGGGGGG - Intronic
1131069519 15:89457018-89457040 ATATACAACCCATTGTAGGAGGG - Intergenic
1132332139 15:101019796-101019818 CTCTCCAGGCCTTAGTAGGGAGG + Intronic
1132846356 16:2002731-2002753 ATCTACAAGGCACAGGAGGCTGG + Exonic
1136653007 16:31688989-31689011 CTCTACAAGCCAGAGGAGAGTGG + Intergenic
1136908740 16:34128462-34128484 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1136992394 16:35161826-35161848 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
1137074536 16:35945498-35945520 ATCTACAAGCCAGAAGAGAGTGG + Intergenic
1137075637 16:35957688-35957710 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
1137316020 16:47324148-47324170 ATCTACAAGCCAGAAGAGAGTGG + Intronic
1137525279 16:49229883-49229905 CTCTACAAGCCAGAATAGAGTGG + Intergenic
1138746123 16:59365007-59365029 CTCTACAAGCCAGAGGAGAGTGG + Intergenic
1138780646 16:59780985-59781007 AACTTCAACCCATTGTAGGGTGG + Intergenic
1138784919 16:59835052-59835074 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1146711022 17:35041546-35041568 AACTTCAAGCCATAGTGGGCTGG + Intronic
1147385244 17:40077258-40077280 ATCTACAAGGCAGAGGATGGTGG - Intronic
1151083562 17:71356277-71356299 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1155811975 18:30248509-30248531 GTCTACAAGGCAAAGTAGAGTGG + Intergenic
1157025474 18:43837289-43837311 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
1157793805 18:50557539-50557561 ATCTAGAAGCCATGGTATAGTGG + Intergenic
1159126477 18:64230668-64230690 CTCTACAAGCCAGAATAGAGTGG - Intergenic
1160431561 18:78816633-78816655 ATTTACAAGCCAAGGGAGGGAGG + Intergenic
1165980458 19:39718272-39718294 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1167973910 19:53208645-53208667 CTCTACAAGCCAGAAGAGGGTGG - Intergenic
927009777 2:18891133-18891155 ATAAACTAGCCAGAGTAGGGTGG + Intergenic
928006689 2:27568729-27568751 ATCTTCAAGCAATAGTACTGGGG - Intergenic
932955746 2:76349501-76349523 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
934693544 2:96380775-96380797 ATCTACAAGCCAGAAGAGAGTGG + Intergenic
940694986 2:156966665-156966687 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
943583690 2:189713430-189713452 ATCTACAAGCCAGAAGAGAGTGG + Intronic
944030611 2:195230111-195230133 ATCTACAAGCCAGAAGAGAGTGG + Intergenic
944033713 2:195268033-195268055 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
944426400 2:199587905-199587927 ATCTGGAAACCATAGTAAGGAGG + Intergenic
944600875 2:201301747-201301769 ATCTACAAGCCAGAAGAGAGTGG + Intronic
947686050 2:232085958-232085980 ATCAACCAGGCATAGTTGGGGGG - Intronic
1170540193 20:17379866-17379888 ATCTACAAGTCAGAGAAGGAAGG + Intronic
1170789394 20:19495258-19495280 ATCTACAAGACATAGTCATGTGG + Intronic
1174511448 20:51056435-51056457 ATCTAAAAGGCATTTTAGGGTGG + Intergenic
1174791168 20:53479838-53479860 ATCTACAATGCATAGACGGGCGG + Intronic
1175470043 20:59221187-59221209 GTCTTCAAGCCAAAGGAGGGAGG + Intronic
1180640820 22:17297939-17297961 CTCTACAAGCCAGAAGAGGGTGG - Intergenic
949816729 3:8066949-8066971 CTCTACAAGCCAGAAGAGGGTGG - Intergenic
951286444 3:20819731-20819753 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
951964822 3:28370434-28370456 AGCTACAAGCAATAGCATGGAGG + Intronic
953340448 3:42130109-42130131 ACCTACAAGCCACAGGATGGAGG - Intronic
955098543 3:55823971-55823993 ATCTGCAAGCCAAAGGAGAGAGG - Intronic
956207230 3:66767992-66768014 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
956482824 3:69689796-69689818 ATGTTCAAACCATAGCAGGGAGG + Intergenic
956565220 3:70629318-70629340 AGCTCCAAGCCATAGAAGGGAGG + Intergenic
959724032 3:109523559-109523581 CTCTACAAGCCAGAATAGAGTGG + Intergenic
960919820 3:122734685-122734707 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
962442869 3:135439091-135439113 CTCTACAAGCCAGAGGAGAGTGG + Intergenic
963027636 3:140935171-140935193 CTCTACAAGCCAGAGGAGAGTGG + Intergenic
963307030 3:143664142-143664164 CTCTACAAGCCAGAATAGAGTGG + Intronic
964228760 3:154437914-154437936 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
964590976 3:158361413-158361435 CTCAACCAGCCATAGGAGGGTGG + Intronic
964848785 3:161071595-161071617 ATCTACAAGCCATAGTAGGGGGG - Exonic
965417975 3:168421020-168421042 CTCTACAAGCCAGAATAGAGTGG + Intergenic
969324956 4:6437898-6437920 AACTACAGGCCTTAGAAGGGAGG + Intronic
970278167 4:14424869-14424891 CTCTACAAGCCAGAATAGAGTGG - Intergenic
971647867 4:29231434-29231456 CCCTACAAGCCAGAGTAGAGTGG + Intergenic
972376698 4:38478275-38478297 ATCTACAAGCCAGAAGAGAGTGG + Intergenic
973055526 4:45652982-45653004 CTCTACAAGCCAGAGGAGAGTGG + Intergenic
973137584 4:46726946-46726968 CTCTACAAGCCAGAATAGAGTGG - Intergenic
974757608 4:66231166-66231188 ATTTGCAAGCCATTCTAGGGGGG + Intergenic
974954431 4:68620571-68620593 CTCTACAAGCCAGAAGAGGGTGG + Intronic
981330269 4:143500122-143500144 AGCTCCAATCCATAGTACGGAGG + Intergenic
981560778 4:146046593-146046615 CTCTACAAGCCACAGGAGAGTGG - Intergenic
983004562 4:162467804-162467826 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
983171852 4:164545037-164545059 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
983486863 4:168342691-168342713 CTCTACAAGCCAGAATAGAGTGG - Intergenic
984015050 4:174416225-174416247 CTCTACAAGCCAGAAGAGGGTGG - Intergenic
988627833 5:32897204-32897226 ACCTACAAGCCAGAAAAGGGTGG - Intergenic
989765418 5:45076864-45076886 ATGGACCAGCCATAGTAGGAGGG - Intergenic
989860799 5:46373044-46373066 CTCTACAAGCCATAAGAGAGTGG + Intergenic
992576639 5:78120002-78120024 CTCTACAAGCCAGAGGAGAGTGG + Intronic
992634237 5:78711545-78711567 CTCTACAAGCCAGAAGAGGGTGG + Intronic
992650200 5:78852386-78852408 CTCTACAAGCCAGAGGAGAGTGG - Intronic
994224661 5:97238596-97238618 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
995116986 5:108492229-108492251 CTCTACAAGCCAGAGGAGAGTGG + Intergenic
995202852 5:109445946-109445968 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
995385051 5:111579842-111579864 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
996162251 5:120180364-120180386 CTCTACAAGCCATAAGAGAGTGG - Intergenic
996752967 5:126908150-126908172 CTCTACAAGCCAGAAGAGGGTGG - Intronic
999049157 5:148503304-148503326 CTCTACAAGCCAGAAGAGGGTGG + Intronic
1002292716 5:178210606-178210628 AACTACAAGCCATACTGAGGCGG + Exonic
1002792842 6:448267-448289 ATCTTCAAACCATAGCATGGGGG - Intergenic
1003891875 6:10570878-10570900 ATCTACAAGGCTTAGAAGTGGGG - Intronic
1004235726 6:13873146-13873168 ATCTACAAGCCACGGAAGGGAGG + Intergenic
1004853215 6:19722245-19722267 ATTTCCAAGGCATAGTTGGGTGG - Intergenic
1004853980 6:19730694-19730716 ATCTGCAGGCAATAGTATGGTGG + Intergenic
1005904451 6:30249034-30249056 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
1009230100 6:61051734-61051756 CTCTACAAGCCAGAGGAGAGAGG - Intergenic
1011188131 6:84701148-84701170 CTCTACAAGCCAGAATAGAGTGG + Intronic
1011306608 6:85934770-85934792 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1013036332 6:106387554-106387576 ATCTAAAACCCTTACTAGGGTGG - Intergenic
1013256293 6:108389707-108389729 TTCTACAAGCCAGAGGAGAGTGG - Intronic
1018749493 6:166790675-166790697 CTCTACAAGCCAGAGGAGAGTGG + Intronic
1018782907 6:167085269-167085291 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1019165363 6:170094680-170094702 ATCTACACCCCACAGTGGGGAGG + Intergenic
1023084521 7:36557314-36557336 CTCTACAAGCCAGAGGAGAGTGG - Intronic
1028836587 7:95381014-95381036 CTCTACAAGCCAGAAGAGGGTGG + Intronic
1029041644 7:97581889-97581911 ACCTACAAGCCAGAGGAGAGTGG + Intergenic
1031705636 7:124977885-124977907 CTCTACAAGCCAGAGGAGAGAGG + Intergenic
1034294229 7:149957680-149957702 ATCTGCAAGCTATAGAATGGGGG - Intergenic
1034811840 7:154139192-154139214 ATCTGCAAGCTATAGAATGGGGG + Intronic
1035493475 7:159300174-159300196 ATCTACAAGCCAGAAGAGAGTGG + Intergenic
1035533103 8:370899-370921 CTCTACAAGCCAGAAGAGGGTGG - Intergenic
1036534289 8:9630355-9630377 ATGTACAAGAAATATTAGGGAGG + Intronic
1038980950 8:32759110-32759132 ATCTAAAAGCCACAGTAGCCAGG + Intronic
1039245513 8:35604373-35604395 CTCTACAAGCCAGAAGAGGGTGG - Intronic
1039707269 8:40020726-40020748 CTCTACAAGCCAGAATAGAGTGG - Intergenic
1040553811 8:48461546-48461568 CTCTACAAGCCAGAAGAGGGGGG - Intergenic
1044455163 8:92385007-92385029 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1046642052 8:116743120-116743142 ATCTACAAGCCCTCGTTTGGAGG + Intronic
1050407845 9:5328723-5328745 CTCTACAAGCCAGAGGAGAGCGG + Intergenic
1052770667 9:32685929-32685951 CTCTACAAGCCAGAATAGAGTGG + Intergenic
1055346449 9:75344902-75344924 CTCTACAAGCCAGAATAGAGTGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1060334613 9:122710395-122710417 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
1187130641 X:16499144-16499166 CTCTACAAGCCAGAGGAGAGTGG + Intergenic
1187374343 X:18738454-18738476 CTCTACAAGCCAGAAGAGGGTGG - Intronic
1190548441 X:51554702-51554724 GTCTACAAGCCAGAATAGAGTGG - Intergenic
1190606545 X:52149463-52149485 CTCTACAAGCCAGAATAGAGTGG - Intergenic
1191063358 X:56321452-56321474 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
1191782172 X:64880491-64880513 ATCTACAAGCCAGAAGAGAGTGG + Intergenic
1191814294 X:65226187-65226209 ATCTACAAGCCAGAAGAGAGTGG + Intergenic
1192843770 X:74883958-74883980 ATCTACAAGCCAGAAGAGAGTGG + Intronic
1192883922 X:75317846-75317868 ATCTACAAGCCAGAAGAGAGTGG - Intergenic
1192909528 X:75588171-75588193 ATCTACAAGCCAGAAGAGAGTGG + Intergenic
1193323775 X:80155632-80155654 CTCTACAAGCCAGAATAGAGTGG - Intergenic
1193395655 X:80981108-80981130 CTCTACAAGCCAGAATAGAGTGG - Intergenic
1193426241 X:81344209-81344231 CTCTACAAGCCAGAATAGAGTGG - Intergenic
1194226000 X:91258604-91258626 CTCTACAAGCCAGAATAGAGTGG - Intergenic
1194417277 X:93629131-93629153 ATCTACAAGCCAGAAGAGAGTGG + Intergenic
1196162753 X:112503711-112503733 CTCTACAAGCCAGAATAGAGTGG + Intergenic
1196171391 X:112591930-112591952 CTCTACAAGCCAGAATAGAGTGG + Intergenic
1196594216 X:117524377-117524399 ATTTACAAACCATTTTAGGGTGG - Intergenic
1196621686 X:117831768-117831790 CTCTACAAGCCAAAGGAGAGTGG - Intergenic
1196722133 X:118864386-118864408 ATCTGCAAGCAAAAGAAGGGAGG - Intergenic
1197489918 X:127103711-127103733 ACCTACAAGCCAGAGGAGAGTGG + Intergenic
1197741133 X:129895004-129895026 TTATACAAGCAGTAGTAGGGCGG - Intergenic
1199302136 X:146224974-146224996 ATATAAAAGCCATATTAGGGAGG - Intergenic
1201524423 Y:14915704-14915726 CTCTACAAGCCAGAGGAGAGTGG - Intergenic
1201780005 Y:17710160-17710182 CTCTACAAGCCAGAAGAGGGTGG + Intergenic
1201821550 Y:18195832-18195854 CTCTACAAGCCAGAAGAGGGTGG - Intergenic