ID: 964850179

View in Genome Browser
Species Human (GRCh38)
Location 3:161087697-161087719
Sequence TGTTCCTGATCTCAAGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964850177_964850179 29 Left 964850177 3:161087645-161087667 CCAGCTGAGACAAGAGGAGGCAC 0: 1
1: 0
2: 0
3: 16
4: 186
Right 964850179 3:161087697-161087719 TGTTCCTGATCTCAAGGCAGAGG 0: 1
1: 0
2: 1
3: 19
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964850179 Original CRISPR TGTTCCTGATCTCAAGGCAG AGG Intronic