ID: 964851679

View in Genome Browser
Species Human (GRCh38)
Location 3:161102759-161102781
Sequence GCTTTTAACAGGATGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964851679_964851685 12 Left 964851679 3:161102759-161102781 CCATGATCCATCCTGTTAAAAGC 0: 1
1: 0
2: 1
3: 12
4: 146
Right 964851685 3:161102794-161102816 GACATGATATAGTTGTGAAAGGG 0: 1
1: 0
2: 3
3: 16
4: 226
964851679_964851684 11 Left 964851679 3:161102759-161102781 CCATGATCCATCCTGTTAAAAGC 0: 1
1: 0
2: 1
3: 12
4: 146
Right 964851684 3:161102793-161102815 GGACATGATATAGTTGTGAAAGG 0: 1
1: 0
2: 1
3: 20
4: 356
964851679_964851683 -10 Left 964851679 3:161102759-161102781 CCATGATCCATCCTGTTAAAAGC 0: 1
1: 0
2: 1
3: 12
4: 146
Right 964851683 3:161102772-161102794 TGTTAAAAGCTTCTTTGGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964851679 Original CRISPR GCTTTTAACAGGATGGATCA TGG (reversed) Intronic
903104196 1:21060714-21060736 GCTTTTCACAGGCATGATCATGG - Intronic
903551207 1:24158326-24158348 GCTCTTAACAGGAAGGCTGAGGG + Intronic
907339746 1:53726490-53726512 GGTTTTAAGAGGAAGAATCAAGG + Intronic
907750423 1:57257873-57257895 TCTTTTAAGAGGATGGCTGAGGG - Intronic
912299974 1:108504823-108504845 GCTTGCACCAGGATGGATGAGGG - Intergenic
913173061 1:116249636-116249658 GCTTTTAACAGCCTGGTTCAGGG + Intergenic
914732343 1:150382783-150382805 GCTATTAACAGGCATGATCAGGG - Intronic
918761518 1:188416701-188416723 GCTTTTAGCAGTCTGGATCCTGG - Intergenic
919420765 1:197367534-197367556 GGTTAGAACAGGATGGTTCAAGG - Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
923155511 1:231275196-231275218 GATTTTAAGAGGAAGGATGAGGG - Intronic
923827149 1:237512944-237512966 GCAATTCACAGGCTGGATCATGG + Intronic
924846666 1:247781101-247781123 GCTTTTCACAGGTGTGATCATGG - Intergenic
1065940492 10:30560030-30560052 CCTTTTAACACCATGGACCAGGG + Intergenic
1066563266 10:36692596-36692618 GCTTTCAGCCGGATGGATCGGGG - Intergenic
1067763007 10:49063896-49063918 GCTGCAAAGAGGATGGATCAGGG - Intronic
1067907594 10:50309833-50309855 GCAGATAACAGGATGGATTATGG - Intronic
1071480568 10:86061858-86061880 GCTTTTAGCAGGCTGAAGCAGGG + Intronic
1072056108 10:91757742-91757764 ACTTTTAACAGGTTTGATGATGG - Intergenic
1080803603 11:35631902-35631924 GCCTTTGATAGAATGGATCATGG - Intergenic
1085806588 11:79642413-79642435 CCTTTTAACAGGAAGAATCAGGG - Intergenic
1086142089 11:83510545-83510567 CGTTTTAGCAGGATGCATCACGG + Intronic
1086268980 11:85036827-85036849 TCTATTAAAAGGATGTATCAAGG + Intronic
1088161762 11:106880263-106880285 GCATTCCACAGGATGGGTCAGGG - Intronic
1088335588 11:108700020-108700042 GCTTTTAATAGGATGCACCATGG - Intronic
1089505243 11:118958086-118958108 TCTTTTGACAGGAAGGAACATGG + Exonic
1090225181 11:125066349-125066371 GCTTTTCACAGGCATGATCATGG - Intronic
1090696352 11:129246864-129246886 TATTTTAACAGCATGGTTCATGG - Intronic
1093084238 12:14848861-14848883 GCTTTTCTCTGGATAGATCATGG + Intronic
1094399977 12:30052252-30052274 GCTTTGAGCAGGATGGACCTTGG + Intergenic
1095370968 12:41466823-41466845 GCTTTTCTCAGCATGGTTCATGG - Intronic
1095694116 12:45125007-45125029 GTTTTTAACAGGAAGGAGAATGG - Intergenic
1098751476 12:74297923-74297945 GCTTATCACAGGATGTGTCAGGG - Intergenic
1103991170 12:124800378-124800400 GCTTTTTACAGAATGGAGGAAGG - Intronic
1109207479 13:59498344-59498366 GCTTTTTACAGATGGGATCAAGG - Intergenic
1110553609 13:76833751-76833773 GCTTTCAAAAGGACGGATCCAGG - Intergenic
1110745612 13:79049959-79049981 GCTATTAACTGGATGGTTAAGGG + Intergenic
1110787726 13:79551579-79551601 CCTTTTAACAGTCTGGATTAAGG + Intronic
1111791905 13:92867937-92867959 GTTATTAACTGAATGGATCAGGG - Intronic
1112470974 13:99688922-99688944 GCTTTTGTCAGGATGAATGACGG - Intronic
1113716736 13:112514504-112514526 GCTTTTAAAATGATTGATGAGGG - Intronic
1118841826 14:69519265-69519287 GCTTTTATCAGGGTTGTTCAGGG + Intronic
1118914508 14:70091342-70091364 GCTTTTAGCAGGAGGGAGAATGG + Intronic
1119941235 14:78643839-78643861 GCCTTTAGAAAGATGGATCAAGG + Intronic
1120035823 14:79696937-79696959 GTTTTTAGGAGGATGGATTATGG - Intronic
1123965434 15:25451200-25451222 GGAATTAACAGGATGGCTCATGG - Intergenic
1124012806 15:25852261-25852283 GCATTTAACAGGAGGGAGGATGG - Intronic
1126666730 15:51081911-51081933 GATTTTAAAAGGAGAGATCAGGG - Intronic
1128632946 15:69283638-69283660 GCTTTTTACAGAATTGATCAAGG - Intergenic
1128657034 15:69469950-69469972 GCTTGCAACAGGATAGATAAGGG + Intergenic
1130247823 15:82269389-82269411 GCTTGTAGCAGGAAGGAGCATGG + Intronic
1132634557 16:936989-937011 GCTTTTATCAGAAGGGACCAAGG + Intronic
1135173988 16:20211813-20211835 GCTTTTAACAGGATGAGAGATGG + Intergenic
1138304668 16:55963555-55963577 GCTTTCAACAGGATGGGCCTGGG - Intergenic
1140401273 16:74673888-74673910 GCTATTGACAGGTAGGATCATGG - Intronic
1141384040 16:83603093-83603115 GCTTTTATGATTATGGATCATGG + Intronic
1144287440 17:13791559-13791581 GCTGTTAACAGGTTGGATCATGG - Intergenic
1145105036 17:20108024-20108046 CCTTTTAACAAGAGGGATGACGG - Intronic
1148596023 17:48856220-48856242 GGTTTTAAGGGGAAGGATCAGGG + Intronic
1148643403 17:49204999-49205021 GCTTTTTACAAGATTGAACAGGG - Intronic
1149379294 17:56077277-56077299 GCATTTCAGAGGATGAATCAAGG - Intergenic
1149618328 17:58021100-58021122 GCTTTTAACGAGATGGATTTGGG + Intergenic
1157800740 18:50618804-50618826 GTGTTTGAAAGGATGGATCAGGG + Intronic
1158540177 18:58346442-58346464 GCCTTTCACAGGATGAAGCATGG + Intronic
1160304548 18:77719581-77719603 GCATTTTACTGGCTGGATCACGG - Intergenic
1166590121 19:43990266-43990288 GCTCTTTACAGGATTGATAATGG + Intronic
928035765 2:27821525-27821547 ACTTTTAAGTGGATGGGTCATGG + Intronic
929439473 2:41953866-41953888 GTTTTAAATAGGATGGGTCATGG - Intronic
930004621 2:46886541-46886563 GCATTTAGCAGGAAGGATAATGG - Intergenic
931801131 2:65758972-65758994 GCTCTTAACAGGCTGGATCCAGG + Intergenic
934125652 2:88886634-88886656 GCTATGAATAGGAAGGATCAAGG - Intergenic
935831297 2:107003335-107003357 GATTTTAACAGGGTGGAGCCAGG + Intergenic
938088213 2:128415584-128415606 ACTTCCAACAGGATGGAGCATGG - Intergenic
942613042 2:177761974-177761996 GCTGTGCACAGGATGGATCTCGG + Intronic
945907820 2:215614760-215614782 GCTTCCAACTGGATGGCTCATGG + Intergenic
948280970 2:236747814-236747836 GCTTTTATCATGATGGCACATGG - Intergenic
948325802 2:237119763-237119785 GATATTAACAGGCTGGACCAGGG - Intergenic
1169033833 20:2433593-2433615 AATTGTAACAGGATGGAACATGG + Intergenic
1170711426 20:18794620-18794642 CCTCTTAACAGGATTGACCATGG - Intergenic
1171337363 20:24396404-24396426 GCTTTTAACAGGTGGGAAAACGG + Intergenic
1172088567 20:32409686-32409708 GCTATTCACAGGGTTGATCATGG - Intronic
1173352181 20:42255238-42255260 GCGGTTAACAGGTTTGATCAAGG - Intronic
1173829539 20:46072383-46072405 GCTATTCACAGGTGGGATCACGG + Intronic
1177794342 21:25757547-25757569 GCTTTTTACAGGAAGGAAAAGGG + Intronic
1179016279 21:37596501-37596523 ACTTTTTACAGGAGGGCTCAGGG - Intergenic
1181659192 22:24329463-24329485 GCTGTTGGCAAGATGGATCATGG - Intronic
1182322695 22:29488831-29488853 GTTTTCTGCAGGATGGATCACGG - Exonic
949926242 3:9044189-9044211 TCTTTTGACAGGATGGCTCAAGG - Intronic
952523071 3:34181772-34181794 GTTTTCAACAGGTTGGATGAAGG + Intergenic
953188458 3:40660803-40660825 GCCTTTAAAAGGATGGACCTGGG - Intergenic
953354751 3:42246234-42246256 GCTTCTAACAGGAGGGAGGAAGG - Intergenic
954300325 3:49697709-49697731 GCTTGTATCAGGAAGGATCCTGG - Intronic
955289484 3:57677739-57677761 ACTTTTAACAGAAAGAATCATGG + Intronic
957509742 3:81171887-81171909 GCATTTAACTTGATAGATCAGGG - Intergenic
960249174 3:115433478-115433500 GCTTTTAACAAGAAGGAATAAGG - Intergenic
961125807 3:124416544-124416566 GCTTTTAAGAGAATGAATCCAGG + Intronic
961186595 3:124920386-124920408 GCTTTTAACAGGATCCAACTGGG + Intronic
961191377 3:124965129-124965151 CCTTTTGGCAGGTTGGATCAGGG - Intergenic
962127084 3:132632047-132632069 CCTTGTAACAGTATGTATCAAGG + Intronic
962351370 3:134658859-134658881 GCTCTTAACAGCATGAATCGTGG - Intronic
964851679 3:161102759-161102781 GCTTTTAACAGGATGGATCATGG - Intronic
965936434 3:174119187-174119209 GCTTCTGAAAGGATGAATCATGG - Intronic
966438943 3:179922127-179922149 GCTTGTAAGATGATGGATCATGG + Intronic
967654750 3:192033509-192033531 GTTTTTAACAGGTTGCAACAAGG + Intergenic
967662771 3:192133320-192133342 GCTTTCAACAGATTGGATGATGG + Intergenic
969480526 4:7444681-7444703 GCTTCTAAAAGGATGGATCTGGG + Intronic
970346842 4:15160474-15160496 TTTTTTAACATGGTGGATCAGGG + Intergenic
972737433 4:41857139-41857161 GCTTTTATAAGGATGGACAATGG + Intergenic
973256770 4:48121325-48121347 GCTTTTGACAAGATGGAGAAGGG - Intronic
975404859 4:73977376-73977398 GATTTTAACATGATAGACCAAGG - Intergenic
977878198 4:102173909-102173931 ACTTTTCACAGGATTGATCAAGG + Intergenic
980806721 4:137825016-137825038 GCTATTCACAGCCTGGATCATGG - Intergenic
984385833 4:179056447-179056469 GTTTTTAATAGAATGGATCAAGG + Intergenic
989255930 5:39365673-39365695 GCTTTTAAAAGCATGGATGCAGG - Intronic
993994370 5:94703731-94703753 GCTTTTCAAAGGAGGGATCTGGG - Intronic
995225994 5:109701759-109701781 CTTTTTAACAGGTTTGATCAAGG + Intronic
996623992 5:125547380-125547402 GTTTTTAACAGAATGGCTTAAGG - Intergenic
996936507 5:128955570-128955592 AATTTTATCAGGATTGATCATGG + Intronic
1003620285 6:7693483-7693505 ACCTTTAAAAGGAAGGATCATGG - Intergenic
1005860862 6:29899081-29899103 GATTTTAACATGAGGTATCAGGG - Intergenic
1006474902 6:34247359-34247381 GCTTGTATCAGGATGGCTGAGGG + Intronic
1008268292 6:49459456-49459478 GCTCTTAACATGGTGGAGCATGG + Exonic
1012183305 6:96182599-96182621 GCTATACACAAGATGGATCAAGG - Intronic
1016046819 6:139489485-139489507 CCTTATAAAATGATGGATCAAGG - Intergenic
1018071682 6:160170217-160170239 GCTGTGAAGAGGATGGAACATGG - Intergenic
1018264579 6:162008817-162008839 GATTTTAACAGGAAAGATAAAGG + Intronic
1018837275 6:167494441-167494463 GCTTTTCACATGATGGAGTAGGG + Intergenic
1018895708 6:168015479-168015501 GCTTTTCACAGGCTGTTTCATGG + Intronic
1024467434 7:49727304-49727326 GATTTGAACAGGATGGATTTAGG + Intergenic
1024571445 7:50725968-50725990 GCTTGTAATGGGATAGATCAGGG - Intronic
1033113255 7:138602154-138602176 GCTATTCACAGGAGTGATCATGG - Intronic
1033795069 7:144836370-144836392 GCTTTTAACCCGACGGCTCAGGG - Intronic
1037812092 8:22092813-22092835 ACTTCTAACAGGCTGGAACAGGG - Intronic
1038557335 8:28533175-28533197 TCCTTTAACAAGATTGATCATGG - Intronic
1039356258 8:36819990-36820012 GCTTTTTACATGATGACTCAGGG - Intronic
1040832381 8:51691733-51691755 GCTTTTAGAAGTATGCATCATGG - Intronic
1046629320 8:116607792-116607814 GCTTTGTGCAGAATGGATCATGG - Intergenic
1048520075 8:135145706-135145728 TCTTTTGTCAGGATGGATGAGGG + Intergenic
1050850320 9:10277075-10277097 GCTATAAACATGATGAATCAGGG - Intronic
1055507972 9:76967095-76967117 GCTATTAGCGGGAGGGATCACGG - Intergenic
1056701943 9:88918272-88918294 GCTTTATACAGCATGGTTCAGGG - Intergenic
1060384990 9:123217289-123217311 TCTGTTAACAGGATGGTTAAAGG + Intronic
1186397113 X:9221009-9221031 GTTTTTAACAAGAGGGCTCATGG - Intergenic
1186525102 X:10241245-10241267 GCTCCTAACAGGTTGGATCCAGG + Intergenic
1187047623 X:15662983-15663005 GCTTATCACAGGAAGGATCTTGG - Intronic
1187111820 X:16309786-16309808 ATTTTTATCAGGAAGGATCATGG + Intergenic
1188612687 X:32119067-32119089 GCTTTTAACACTATAGAGCAAGG - Intronic
1189870775 X:45381015-45381037 GCTTTTTACAGGTTGGCTCCAGG + Intergenic
1190295266 X:49022989-49023011 GCTATTCACAGGAGTGATCATGG + Intergenic
1190518596 X:51251975-51251997 GTTTTTAATATGATGGATAATGG + Intergenic
1192529919 X:71875142-71875164 GACTTTAAGAGGCTGGATCAAGG - Intergenic
1193081907 X:77414468-77414490 GCTCTTAAAAGGAGGGATGAAGG - Intergenic
1196000982 X:110785584-110785606 TTTTTAAACAGTATGGATCAGGG - Intronic
1198889710 X:141380155-141380177 GCTTTTAACATGAGGGATGCTGG - Intergenic
1199617924 X:149672391-149672413 GGTTTTAACAGGAGGGATGAGGG + Intergenic
1199624718 X:149730858-149730880 GGTTTTAACAGGAGGGATGAGGG - Intergenic
1202248022 Y:22839475-22839497 GCTTTATACAGCATGCATCAGGG - Intergenic
1202401010 Y:24473223-24473245 GCTTTATACAGCATGCATCAGGG - Intergenic
1202469770 Y:25196863-25196885 GCTTTATACAGCATGCATCAGGG + Intergenic
1202592342 Y:26499118-26499140 GCTTTTTAAAGGATAGATGAGGG + Intergenic