ID: 964851747

View in Genome Browser
Species Human (GRCh38)
Location 3:161103354-161103376
Sequence CTTGTAAAGGGCATTATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964851747 Original CRISPR CTTGTAAAGGGCATTATTAT GGG Intronic
901095998 1:6680608-6680630 CTTCTAAAGGGAACTCTTATAGG - Intronic
901947213 1:12713525-12713547 GTGGTAAAGGGCAATATTGTGGG - Intergenic
906921193 1:50066090-50066112 ATTGCAAAGGGCATAGTTATAGG + Intronic
911418246 1:97604739-97604761 CTTCTAAAGGGCATTCTTGATGG + Intronic
916296074 1:163221980-163222002 TGAGTAAAGGTCATTATTATAGG - Intronic
916468888 1:165102820-165102842 CTTGTAATGGAATTTATTATTGG + Intergenic
916844367 1:168633454-168633476 TATGTAAAGGGCATTATTCAAGG + Intergenic
917521677 1:175752948-175752970 CTTGGGAAGGGCATTTTTAGAGG - Intergenic
918838875 1:189507291-189507313 CTTGTAAAGAATATTATTGTTGG + Intergenic
918861680 1:189834973-189834995 CTTGTATAGGGCATCTTTACGGG + Intergenic
919294781 1:195683148-195683170 CTTGTAATGGGCATAATTGTTGG - Intergenic
1063268562 10:4481562-4481584 CTTGTAAAGGGCAATGATAAGGG - Intergenic
1064156193 10:12905362-12905384 CTTGTAAAGGGCCAGATTTTAGG - Intronic
1064487509 10:15810215-15810237 TTTTTAAAGGGCACTAGTATAGG - Intronic
1064627863 10:17279930-17279952 CTTGTAATTGCCAATATTATGGG - Intergenic
1071368321 10:84924164-84924186 CTTGTACAAGGTGTTATTATAGG + Intergenic
1072856366 10:98951767-98951789 CCTGTAAAGGGCACTATCCTTGG - Intronic
1074727168 10:116323542-116323564 CTTCTAAATGACATGATTATGGG + Intergenic
1074840035 10:117341972-117341994 CCTGAAGAGGGCAATATTATTGG + Intronic
1075169438 10:120099760-120099782 GTTGTAACGGGCATTATCCTTGG + Intergenic
1077779636 11:5312415-5312437 TTTTTTAAGGGCACTATTATGGG - Intronic
1085667681 11:78429946-78429968 CTTATAATGGGCATTTCTATTGG - Intergenic
1087561985 11:99802437-99802459 CTTGCAAACGGCACTATTAATGG - Intronic
1090901914 11:131039416-131039438 GATGGAAAGGGCATCATTATTGG + Intergenic
1091370331 11:135052098-135052120 TTTGTAAATGGCATCATCATGGG + Intergenic
1095315978 12:40762213-40762235 CTTGTAAATGGCTATATTAGAGG - Intronic
1099291248 12:80778804-80778826 CTTCTTAAGGAGATTATTATGGG - Intergenic
1099819659 12:87693879-87693901 CTTGTAGAAGGCACTATTAATGG - Intergenic
1105631921 13:22177844-22177866 CTTGGCAAGGGCAATTTTATGGG + Intergenic
1105969828 13:25418233-25418255 AATGTTAAGGGCATTATTACGGG - Intronic
1109338467 13:61023573-61023595 ATTTTAAAAGTCATTATTATTGG - Intergenic
1110496263 13:76172008-76172030 CTTGTAAAGAGGATTGTTCTGGG - Intergenic
1112885590 13:104167179-104167201 CTTATAAAGGGCATTGATAGAGG - Intergenic
1116171237 14:41405844-41405866 TTTGTAAAGGGCTTTATAAGTGG + Intergenic
1119099148 14:71863981-71864003 CTTGTAAAGGACATGCTTAGAGG - Intergenic
1119370477 14:74136887-74136909 CTTGTAGAAGGGATAATTATTGG + Intronic
1121032047 14:90666543-90666565 CTTCTAAAAGGCATATTTATGGG + Intronic
1125291128 15:38148206-38148228 CTTATAAAGGGAATGATTATTGG + Intergenic
1140301071 16:73757688-73757710 TATGTAAATGGTATTATTATTGG + Intergenic
1144378706 17:14671369-14671391 CTTGGAAAAGGCATTTTTCTAGG + Intergenic
1154039333 18:10838166-10838188 ATTGTAAAAGACAGTATTATAGG - Intronic
1157724915 18:49956936-49956958 CTGCTAAAGGGCTTTTTTATGGG + Intronic
1160376446 18:78416940-78416962 AATGTAAAGGGCAGTATCATAGG - Intergenic
1162784178 19:13023889-13023911 GTTTTAAAGGGGGTTATTATTGG - Intronic
1162992422 19:14312241-14312263 CGTGTAATGGGCTATATTATGGG + Intergenic
1165524413 19:36341685-36341707 TTTGTAACAGGCATTATTTTAGG - Intronic
926556454 2:14363567-14363589 CATGGAAAGGGCATTATTTGGGG + Intergenic
929318549 2:40511867-40511889 CTTGTAAACGACATTATTTTTGG - Intronic
930649845 2:53953533-53953555 CTTTTAAAATGCATTATTCTTGG + Intronic
932872702 2:75419317-75419339 CTTGTAAAAGGTATTTTTCTGGG - Intergenic
933819094 2:86093525-86093547 CCTGTAAAGGATATTATTAAAGG - Intronic
936040545 2:109146185-109146207 CTAATAATGGCCATTATTATTGG + Intronic
937704348 2:124901821-124901843 CTTAGAAAAGGCATTATTAAAGG + Intronic
938884310 2:135627735-135627757 CTTCTAAAAGTCATTTTTATTGG + Intronic
939854206 2:147338020-147338042 CTTATAAAGGGTATAATTTTTGG + Intergenic
941374163 2:164706907-164706929 CTTATAAAGGGAACTATTAGTGG - Intronic
941440595 2:165530200-165530222 CTTGTAAAGGGAATTTTGAAAGG - Intronic
942912083 2:181256156-181256178 CTTCTAAATGGCAGTACTATTGG - Intergenic
943827246 2:192412163-192412185 CATGTTAAGGCCATTATCATTGG + Intergenic
945797273 2:214380188-214380210 GTTTTAAAGGCCATTACTATAGG - Intronic
945905224 2:215585684-215585706 CTTGTAAAGAGCATGTTTAATGG - Intergenic
947302872 2:228707619-228707641 CTTATGATGGCCATTATTATAGG + Intergenic
947663298 2:231886151-231886173 CTTCTAAAGGGCTTTATTTAAGG + Intergenic
1169926194 20:10787098-10787120 CTTGAAAATGTCAGTATTATGGG + Intergenic
1170988344 20:21279139-21279161 GCTGTAAAGGACATTATTAGGGG + Intergenic
1173076924 20:39828152-39828174 CATGGAAAGGGCAGTATTATGGG + Intergenic
1176055140 20:63141304-63141326 CTTGTCAAGGGCATCGTTAAAGG + Intergenic
1178345915 21:31827912-31827934 CCTCTAAAAGGCACTATTATGGG + Intergenic
950818782 3:15735447-15735469 CTTGTCAAAAGCATTAATATTGG + Exonic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
956247226 3:67197429-67197451 CTTGTTTTGGGTATTATTATAGG - Intergenic
957585049 3:82122374-82122396 ATTTTAAAGAACATTATTATAGG + Intergenic
958558378 3:95708911-95708933 CTTTTAAATGGGATTATTAGGGG + Intergenic
958866593 3:99508189-99508211 CGTCTAAGGAGCATTATTATGGG + Intergenic
960028419 3:113033666-113033688 TATGTAAAGGGGATTATTCTGGG - Intergenic
960821131 3:121733353-121733375 GTTGTAAATGGTATTCTTATTGG - Intronic
960851846 3:122063807-122063829 CTTCTAAAGTGCTGTATTATAGG + Intronic
962199971 3:133393002-133393024 CTTGTGAAGGGCATGAGAATGGG - Intronic
962665607 3:137650964-137650986 CTAGTTAAGGGCCTTGTTATAGG + Intergenic
964303121 3:155310900-155310922 CATTTAAAAGGCTTTATTATGGG - Intergenic
964851747 3:161103354-161103376 CTTGTAAAGGGCATTATTATGGG + Intronic
965488416 3:169307203-169307225 ATTGCAAAGGGGATTATTAAAGG - Intronic
966369689 3:179236188-179236210 CCCTTAAAGGGCATAATTATTGG + Exonic
968535872 4:1128808-1128830 CTTGTACACTGCATTATAATTGG - Intergenic
968710232 4:2109780-2109802 CTTATAAACAGCATTATAATTGG + Intronic
971530723 4:27685217-27685239 CTTTTGAAGTGCATTATTAAAGG - Intergenic
974821935 4:67078064-67078086 CTTGAAAAGTGCATGCTTATTGG - Intergenic
975056035 4:69930068-69930090 TATGAAAAGGGCATTATTCTGGG - Intergenic
977020419 4:91752231-91752253 CTTTTAAAGGGGATTATAAATGG + Intergenic
977343403 4:95788889-95788911 GCTGTGAAGGCCATTATTATTGG - Intergenic
978959240 4:114655807-114655829 CTTATTAAGGACATTATTAGTGG - Intronic
980176551 4:129352967-129352989 CTTTTAAATGGCACTATCATAGG - Intergenic
986965804 5:13269183-13269205 ATAGTAAAGAGCATTATGATAGG + Intergenic
989403103 5:41030352-41030374 GTTGTAAAAGGGATTATTGTTGG - Intronic
991260189 5:64658848-64658870 CTTGTAAAGTGCATTAGAAAAGG + Intergenic
993331207 5:86602678-86602700 CCTCCAAAGGGGATTATTATAGG + Intergenic
993865069 5:93184624-93184646 CTTGCAAAGTCCATTTTTATTGG + Intergenic
994141655 5:96348144-96348166 CTTGTCAAGGGCAGTATCAGTGG + Intergenic
996579779 5:125018414-125018436 CTTATAAAGCTCATTATTAAAGG + Intergenic
997036214 5:130195026-130195048 CTTATAAAGCACATTATTTTAGG - Intergenic
997854425 5:137360601-137360623 TTTCTAAAGGGCTTTATTTTAGG + Intronic
1007529379 6:42527506-42527528 CTGGTAAAGGGAATTATAACAGG - Intergenic
1009943011 6:70311059-70311081 CTTATCAAGGGCAGTATTACAGG - Intergenic
1009967261 6:70590840-70590862 CTTGCAGATGGCATTATCATGGG - Intergenic
1010919302 6:81662109-81662131 CTTGTTAAGGGAATCATAATGGG + Intronic
1012457204 6:99420682-99420704 CTTGTAAATGTCATTTTTAATGG - Intronic
1012611096 6:101221978-101222000 TCTTTAAAGTGCATTATTATTGG + Intergenic
1016631132 6:146233038-146233060 CTTGGAAAAGACAGTATTATTGG - Intronic
1018280741 6:162182929-162182951 CTTCTAAAATGCATTATTATTGG + Intronic
1022937837 7:35198911-35198933 CCTGTGTAGGGCTTTATTATAGG - Intergenic
1023447789 7:40250094-40250116 CTTTTAAAGGTAATTATTCTTGG + Intronic
1028074671 7:86497188-86497210 AATGTTAAGGGCATTAATATGGG - Intergenic
1028195632 7:87904153-87904175 CTAGTAAAGGGTATTATCTTTGG + Intronic
1030739983 7:113097632-113097654 CTTGTAACAGGCACTACTATAGG - Intergenic
1031280939 7:119798233-119798255 CTTGTGAAGGGCATGATAAATGG + Intergenic
1031602158 7:123723092-123723114 CATGTAAAGTTCCTTATTATAGG + Intronic
1034860473 7:154590897-154590919 CTTGTCGAGGCCATCATTATGGG - Intronic
1042151200 8:65786810-65786832 CTTGTAAAGCGAACTAGTATAGG + Intronic
1043190459 8:77215031-77215053 TTTGGAAAGGGCAGTATTTTGGG + Intergenic
1044738636 8:95303606-95303628 TTTGAAATGGGGATTATTATGGG + Intergenic
1046739132 8:117810187-117810209 CCTATAAAGGGCATTATAGTTGG - Intronic
1046747879 8:117895606-117895628 TCTGTAATTGGCATTATTATTGG - Intronic
1046767009 8:118080648-118080670 ACTTTAAAAGGCATTATTATTGG - Intronic
1047465512 8:125109258-125109280 TTTATAAAAGGCATTATTGTGGG + Intronic
1047804274 8:128343070-128343092 CTTGTATAGGGCATTATTCTAGG + Intergenic
1047863217 8:128991747-128991769 CTTAGAAAGGGCCTTATTTTTGG + Intergenic
1048949834 8:139487078-139487100 CTTGAAAAGGTGAGTATTATAGG - Intergenic
1050360962 9:4830663-4830685 CATGTACTGGGCATTATTCTAGG + Intronic
1050639261 9:7649053-7649075 CTGATAATGGGCATTGTTATGGG + Intergenic
1052708180 9:32018789-32018811 CTAGAAGAGGGCATTGTTATAGG + Intergenic
1053729155 9:41034969-41034991 CTTGAAAATGGCATTCTTTTGGG - Intergenic
1054699357 9:68397098-68397120 CTTGAAAATGGCATTCTTTTGGG + Intronic
1055206577 9:73738026-73738048 CTGGTAAAGGGTATTAATAACGG - Intergenic
1055788161 9:79893164-79893186 CTTGTAAAGTGCTCTAATATTGG + Intergenic
1056879481 9:90377686-90377708 TTTGTAAAGAGCATAAATATAGG - Intergenic
1059266278 9:113034431-113034453 CTTGCAAAGGGCATGACTTTAGG - Intergenic
1188031695 X:25270818-25270840 TTTCTAAAGAGAATTATTATAGG + Intergenic
1190463886 X:50706723-50706745 TTTGTAAAAAGCATTATTATTGG + Intronic
1192005207 X:67204269-67204291 CTTGTAAAGGGTAAAATTCTAGG + Intergenic
1195538948 X:106040442-106040464 TTTGTACGGGGCACTATTATAGG - Intergenic
1196336789 X:114546074-114546096 CTTGTAAAAGTCATTTTAATTGG + Intergenic
1199247893 X:145627816-145627838 CATGCAAACAGCATTATTATCGG + Intergenic
1201583840 Y:15538737-15538759 CTTTTCATGGGCATTATTAATGG + Intergenic