ID: 964863479

View in Genome Browser
Species Human (GRCh38)
Location 3:161228277-161228299
Sequence GGGGTTGGCTGGGACCTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964863479_964863487 3 Left 964863479 3:161228277-161228299 CCTACTAGGTCCCAGCCAACCCC 0: 1
1: 0
2: 1
3: 7
4: 150
Right 964863487 3:161228303-161228325 AATTTCTGATGGTCACTTTTTGG 0: 1
1: 1
2: 0
3: 25
4: 300
964863479_964863483 -8 Left 964863479 3:161228277-161228299 CCTACTAGGTCCCAGCCAACCCC 0: 1
1: 0
2: 1
3: 7
4: 150
Right 964863483 3:161228292-161228314 CCAACCCCACAAATTTCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 161
964863479_964863488 12 Left 964863479 3:161228277-161228299 CCTACTAGGTCCCAGCCAACCCC 0: 1
1: 0
2: 1
3: 7
4: 150
Right 964863488 3:161228312-161228334 TGGTCACTTTTTGGCGCTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964863479 Original CRISPR GGGGTTGGCTGGGACCTAGT AGG (reversed) Intronic
900699224 1:4033594-4033616 GGGCTTGGCTGGCACATAGCAGG + Intergenic
902098744 1:13967647-13967669 GGGATTGGCTGTGACAGAGTAGG + Intergenic
902251067 1:15154320-15154342 GTGGTTTCCTGGGACCTACTGGG - Intronic
903464190 1:23540658-23540680 GGGGGTGGCTGGGCCGTGGTGGG - Intergenic
906733833 1:48105492-48105514 GGGGTTATCTGGCACATAGTAGG + Intergenic
907309665 1:53532029-53532051 GGGGTGGGCTGGGCTCTACTGGG + Intronic
915324478 1:155073813-155073835 GGGGAATGCTGGGACCTACTGGG + Intergenic
915736315 1:158087821-158087843 GGGGTTGGCTGTGGCCTGGCAGG - Exonic
916179574 1:162071616-162071638 GGGTATGGCTGGGACAGAGTGGG + Intronic
916353232 1:163875848-163875870 GAGGTTGTCTGGGACCAAGATGG + Intergenic
921380394 1:214518655-214518677 TGGGTTGGCTGGGTGCAAGTGGG + Intronic
921713113 1:218392660-218392682 GGGGTTGCCTGGCACCTACTAGG - Intronic
1062917234 10:1250308-1250330 GGGGGGTGATGGGACCTAGTGGG + Intronic
1066054841 10:31671132-31671154 GGGAGTGGGTGGGACCTTGTAGG + Intergenic
1067523912 10:47027121-47027143 GGGGTTTGATGGGGCCCAGTGGG + Intergenic
1069782303 10:70964601-70964623 GGAGATGGCTGGCACATAGTAGG + Intergenic
1070288553 10:75100373-75100395 GGGATGGGCTGGGTCCCAGTGGG - Intronic
1070748776 10:78951536-78951558 GGGCTCCGCTGGGACGTAGTTGG - Intergenic
1071271484 10:84011523-84011545 TGGGTTGGCTGGGACTCAGCTGG + Intergenic
1073293250 10:102423762-102423784 GGGCTGGGCTGGGCCCTAGAGGG - Intronic
1074302240 10:112242946-112242968 TGGGGTGCATGGGACCTAGTGGG - Intergenic
1075378384 10:121997918-121997940 GGGGTGGGATGGGACCTCTTGGG - Intronic
1076798485 10:132810060-132810082 GGGGCTGTCTGGGAACCAGTGGG - Intronic
1077923564 11:6658918-6658940 GGATTTGGCTGGGGCCTAGGGGG + Intergenic
1079540968 11:21574168-21574190 AGGGTTTGATGGGACCAAGTAGG - Intronic
1080085994 11:28282807-28282829 TGGGTTGACTGAGGCCTAGTTGG - Intronic
1083399066 11:62411503-62411525 GGGGCAGGCTGGGACCTGTTGGG - Intronic
1083662551 11:64258477-64258499 GCAGCTGGCTGGGACCTCGTCGG + Exonic
1084209211 11:67613241-67613263 AGGGTTGGCTGGGACCTGCCTGG + Intergenic
1084650645 11:70487275-70487297 GGGCTTGGCGGGGACGTAGACGG + Intronic
1085407246 11:76270479-76270501 AGGGGTGGCTGGGACAGAGTGGG - Intergenic
1085617902 11:78015553-78015575 TGGGTTGTCTGGGACCTTCTTGG - Intergenic
1087283693 11:96241483-96241505 GGGGTCTACTGGCACCTAGTGGG + Intronic
1089773057 11:120816931-120816953 GAGGCTGGGAGGGACCTAGTAGG - Intronic
1090279285 11:125442311-125442333 GGGAGTGCCTGGGACATAGTGGG + Intergenic
1093353385 12:18131852-18131874 CGGGTTGGATGGGAACTAGTGGG + Intronic
1094415479 12:30210827-30210849 GGGGATGGCTTGAACCTAGGAGG + Intergenic
1096380820 12:51156471-51156493 GGAGGTGGGTGGGGCCTAGTGGG - Intronic
1097068799 12:56339810-56339832 GGAGTTGGCTGAGGCCCAGTAGG - Exonic
1100302640 12:93322063-93322085 GGCTATGGCTGGAACCTAGTGGG + Intergenic
1102887526 12:116533359-116533381 GGGCCTGGCTGGGGCTTAGTCGG - Intergenic
1106344104 13:28859243-28859265 AGGGGTGGCTGGGGCCCAGTGGG + Intronic
1120886896 14:89458778-89458800 GTGATTGACTGGGACCTAGAGGG - Intronic
1122441708 14:101736619-101736641 GGGCCTGGCTGGGACCCAGCTGG + Intergenic
1128064400 15:64755424-64755446 TGGGGTGGCTGGAATCTAGTAGG - Intronic
1129869803 15:78933024-78933046 GGGGTTGTCTGGCAGTTAGTTGG - Intronic
1131049909 15:89340768-89340790 GGGCCTGGCTGGGATCTAATAGG - Intergenic
1133751009 16:8725378-8725400 GGGGTTGGCAGGGGCCTGGGAGG - Intronic
1134246557 16:12544483-12544505 GGGGTCGGCTGGGGTCTAGATGG + Intronic
1135589027 16:23692063-23692085 GTGGTTGCCCGGGACCTGGTTGG - Exonic
1137374626 16:47942023-47942045 GGGGTTGGCCTGGAGCTGGTGGG - Intergenic
1137825974 16:51495487-51495509 GGGGGTGGCTGGTACCCGGTAGG - Intergenic
1138497294 16:57416260-57416282 GGGGTTGGCGGGGTCCTGGGAGG + Intergenic
1139535975 16:67574099-67574121 GGTGTTGGATGACACCTAGTTGG - Intronic
1140519131 16:75566695-75566717 GGGCCTTGCTGGGAGCTAGTAGG + Intronic
1142288095 16:89179607-89179629 GGGGTAGGCTGGTCCCCAGTGGG + Intronic
1142660306 17:1424566-1424588 GGGGTTTTCTGGGAGCTAATTGG - Intronic
1143570852 17:7757450-7757472 GGGGTGGGAGGGGACCTGGTTGG - Intronic
1144685379 17:17222720-17222742 GGAGTTGGCTGTGAACGAGTAGG - Intronic
1144702104 17:17346798-17346820 GGGGTTGGCTCGGCCCCTGTGGG - Exonic
1144905051 17:18635154-18635176 GGCCTTGGCTGGGACAGAGTGGG - Exonic
1146176338 17:30668298-30668320 GGGGATGGCTGGGAACTCGGAGG + Intergenic
1146349798 17:32084412-32084434 GGGGATGGCTGGGAACTCGGAGG + Intergenic
1147585472 17:41651771-41651793 AGGGCAGCCTGGGACCTAGTGGG - Intergenic
1148337123 17:46849450-46849472 GGGTGTGGCTGGGGCCTGGTGGG + Intronic
1148797940 17:50206143-50206165 GGGCCTGGCTGGGACCTGGTGGG - Intergenic
1151483267 17:74382982-74383004 TGGTGTGGCCGGGACCTAGTGGG + Intergenic
1151725619 17:75882083-75882105 AGGGTTGGCTGGGACCCAACCGG - Intronic
1152457765 17:80425949-80425971 GGGGCTGGCTGGGAACTGGCAGG - Intronic
1154488687 18:14902165-14902187 GGGGGTGGCAGGGACCGGGTTGG - Intergenic
1155412464 18:25561753-25561775 GGGTTTGGCTTTGACCTTGTGGG + Intergenic
1156386147 18:36606947-36606969 GGGGTTGCCTGAGGCCTTGTGGG - Intronic
1157078723 18:44497973-44497995 GGGCCTGGCTGGCACCTAGATGG - Intergenic
1158883657 18:61805256-61805278 GGGGTTGGGGGGAACTTAGTAGG - Intergenic
1159371337 18:67530980-67531002 ATGGATGGATGGGACCTAGTTGG + Intergenic
1159689121 18:71463400-71463422 GGGTGTGCATGGGACCTAGTTGG + Intergenic
1160348751 18:78155884-78155906 GGTGTTGGGAGGGACCCAGTGGG - Intergenic
1160783988 19:891374-891396 CGGGAGGGCTGGGACCTATTTGG + Intronic
1165935002 19:39383812-39383834 GGGGTGGGATGGGACCAGGTGGG - Exonic
1166366442 19:42280716-42280738 GGGGTTGGCTGGGGGCCAGGCGG + Intronic
1166858103 19:45793150-45793172 GGGGTTGGCTGTGACTTCATGGG - Intergenic
1167510780 19:49894510-49894532 GGGGTGGCCTGGTCCCTAGTGGG + Intronic
926056829 2:9778591-9778613 GGGGTTGGCAGGAACCAAATGGG + Intergenic
926711909 2:15888696-15888718 GGGGTGGGCTGTGGCCTGGTAGG + Intergenic
927084032 2:19656779-19656801 GGGGTTGTCTGAGACCTTGGGGG - Intergenic
927959716 2:27233534-27233556 GAGGTGGGCTGGGACCTGGTGGG + Exonic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
928443265 2:31311394-31311416 GGGGCTGGGTGGGACACAGTGGG - Intergenic
929575666 2:43050278-43050300 GGGGTTGGCTGGGAACCCTTGGG - Intergenic
929873045 2:45774171-45774193 GGGCTTGGCTGGGACATGTTGGG + Intronic
931497300 2:62822304-62822326 AGGTTTGGCTTGAACCTAGTGGG + Intronic
932276902 2:70458454-70458476 TGGATTGGCTGGAACCTAGGTGG - Intronic
935552425 2:104472066-104472088 AGGGTTGGCTGGGAGTTGGTTGG + Intergenic
937837916 2:126492631-126492653 GGGGTTGGCGGGGAGCTTCTGGG + Intergenic
938791436 2:134679848-134679870 AGGGTGGGCGGGGACCTTGTGGG - Intronic
939111925 2:138018704-138018726 GGTGATGTCTGGGACCTGGTAGG - Intergenic
940011599 2:149060579-149060601 GGGTTTGGCTGAGACCTGGCTGG + Intronic
941385121 2:164842086-164842108 GGGGTGGGCCGGGAGCAAGTTGG + Intronic
944685655 2:202115342-202115364 GGGGTGGGCTGGAATATAGTAGG - Intronic
946224829 2:218258882-218258904 GGGGTTTGCTGGACCCTGGTTGG - Intergenic
947029884 2:225782298-225782320 GGGGCTGGCTGTGCCCAAGTTGG - Intergenic
948944723 2:241213699-241213721 GGGCTGGGCTGGGACCTAAGTGG + Intronic
1169973879 20:11301893-11301915 GGGGCTGGCTGGGCCCTGGGTGG + Intergenic
1171247677 20:23625761-23625783 GCGGTTGGCTGGTACCGTGTAGG + Intergenic
1173165587 20:40684972-40684994 GGGGTTGGGGGTGACCTAGGTGG + Intergenic
1173313433 20:41921190-41921212 GGGGTTGGCTGGGACCAGCTAGG - Intergenic
1174567719 20:51478792-51478814 GGTGTTGGCAGGAGCCTAGTGGG - Intronic
1175889288 20:62309321-62309343 GGGGTTGGCTGTGTCCTAGGCGG + Exonic
1175990285 20:62785310-62785332 GGGGCTGGGTGGGACCGGGTGGG + Intergenic
1176303915 21:5113699-5113721 GGGGGTGGCTTGGACATATTTGG + Intergenic
1179423011 21:41251108-41251130 GTGGTTGGCTGGGTCCCGGTTGG + Intronic
1179853115 21:44148251-44148273 GGGGGTGGCTTGGACATATTTGG - Intergenic
1181115538 22:20630897-20630919 GGGAGTTGCTGGGACCTACTGGG + Intergenic
1181541478 22:23575269-23575291 GGGAGTTGCTGGGACCTACTGGG - Intronic
1181551360 22:23640628-23640650 GGGAGTTGCTGGGACCTACTGGG - Intergenic
1181796903 22:25318033-25318055 GGGAGTTGCTGGGACCTACTGGG + Intergenic
1184391858 22:44207439-44207461 GGGGAGGGCTGGGGCCTGGTGGG + Exonic
1185294329 22:50045917-50045939 GGGGTTGGCCGGGACGTACCAGG + Exonic
953212224 3:40886160-40886182 GTGGTTGGGTGGGACCTGGCAGG - Intergenic
954815002 3:53273428-53273450 TGGGGTGACTGGGACCTGGTAGG + Intergenic
954838158 3:53489509-53489531 TGGTTAGGCTGGGACCTAGGGGG - Intergenic
956593735 3:70944569-70944591 GAGGGTGGCTGGGACCTATAGGG - Intergenic
964863479 3:161228277-161228299 GGGGTTGGCTGGGACCTAGTAGG - Intronic
968705602 4:2076046-2076068 GGGCTTGGCTGGGGCCTGGCTGG - Intronic
968984792 4:3869245-3869267 TGTGGTGGCTGGGTCCTAGTGGG + Intergenic
969111310 4:4846076-4846098 GGGGTCTGCTGTGCCCTAGTGGG - Intergenic
970271889 4:14357039-14357061 GGGGTTAGCTGAGACCTCGGTGG - Intergenic
974580527 4:63794734-63794756 GTGTTGGGCTGGGGCCTAGTGGG + Intergenic
975938860 4:79616008-79616030 GGGCTTAGGTGAGACCTAGTTGG + Intergenic
976877776 4:89876673-89876695 CAGTGTGGCTGGGACCTAGTAGG + Intergenic
979363464 4:119792255-119792277 GGGGTGGGATGGGACCTAGTAGG + Intergenic
982054426 4:151533300-151533322 GGGGTTGGGGGGCACCTAGGCGG + Intronic
985110172 4:186540195-186540217 TGGGTTGTCAGGGACCTGGTGGG - Intronic
992188636 5:74268299-74268321 GTGGAAGGCTGGGACCTACTGGG + Intergenic
997860884 5:137414853-137414875 GGGGTGGGCGGGGACATACTTGG - Intronic
998131006 5:139651033-139651055 GGGGCTGGCTGGGAACTCGGAGG - Intronic
999435149 5:151557900-151557922 GGGGTTGGCAGGGCCATAGGAGG - Intronic
1000518255 5:162267430-162267452 GGGTGTGTCTGGGCCCTAGTAGG - Intergenic
1001514583 5:172346362-172346384 GGGGGTGCTGGGGACCTAGTTGG + Intronic
1005186908 6:23172662-23172684 GGGAGTTGCTGGGACCAAGTAGG + Intergenic
1006317010 6:33297283-33297305 GGGGCTGTCTGGGCCCCAGTGGG - Intronic
1014619465 6:123647777-123647799 AGGGTTTGCTGGGACATAGATGG - Intergenic
1018799993 6:167214506-167214528 GGGGATGGCTGGAGCCCAGTGGG + Intergenic
1018813018 6:167311371-167311393 GGGGATGGCTGGAGCCCAGTGGG - Intronic
1020023422 7:4882932-4882954 GGGGTTGGCAGGGCCCTGGCGGG - Intronic
1022439743 7:30423886-30423908 GGGGTTGGGAGGGACCTCGTAGG + Intergenic
1029426222 7:100495623-100495645 GAGGATGGCTGGAACCTAGAAGG + Intergenic
1038277413 8:26133588-26133610 GGGGATGGCTGGAACTTGGTAGG - Intergenic
1048053926 8:130846215-130846237 GGGGTTGGCTGGGGTCTGCTGGG + Intronic
1051173265 9:14340915-14340937 GGGGTTGGGTGGGAGCGGGTGGG + Intronic
1051774653 9:20621213-20621235 GGAGGTGGCTGGGACCCAGGGGG + Intronic
1056936004 9:90915075-90915097 GGTGTTGGCTGCCATCTAGTGGG - Intergenic
1059456312 9:114402405-114402427 GGGATGGGCTGGGTCCTAGCTGG + Exonic
1060532161 9:124354267-124354289 GGTGTTGGGTGTGTCCTAGTGGG - Intronic
1060768239 9:126310979-126311001 GGAGTTGGCTGGGTTCTACTAGG - Intergenic
1187987194 X:24827151-24827173 AGGGTTGGCTGGTACCTCCTCGG - Intronic
1189195500 X:39148871-39148893 GGGGCTGGCTGAGAGATAGTGGG - Intergenic
1195702577 X:107716290-107716312 AGGTTTGCCTGGGACCTTGTAGG - Intronic
1198556622 X:137799998-137800020 GGGTATTGCTGGCACCTAGTGGG - Intergenic