ID: 964869404

View in Genome Browser
Species Human (GRCh38)
Location 3:161296831-161296853
Sequence GTCCTGTGAAAACTATCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964869404_964869405 19 Left 964869404 3:161296831-161296853 CCACTTGATAGTTTTCACAGGAC No data
Right 964869405 3:161296873-161296895 TTTGATCTTCACAGCCATCCTGG No data
964869404_964869406 20 Left 964869404 3:161296831-161296853 CCACTTGATAGTTTTCACAGGAC No data
Right 964869406 3:161296874-161296896 TTGATCTTCACAGCCATCCTGGG No data
964869404_964869407 23 Left 964869404 3:161296831-161296853 CCACTTGATAGTTTTCACAGGAC No data
Right 964869407 3:161296877-161296899 ATCTTCACAGCCATCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964869404 Original CRISPR GTCCTGTGAAAACTATCAAG TGG (reversed) Intergenic
No off target data available for this crispr