ID: 964869770

View in Genome Browser
Species Human (GRCh38)
Location 3:161300717-161300739
Sequence CACTGTAAAGACCCTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964869770_964869772 -5 Left 964869770 3:161300717-161300739 CCTGCATCAGGGTCTTTACAGTG No data
Right 964869772 3:161300735-161300757 CAGTGGTAGTTCTCTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964869770 Original CRISPR CACTGTAAAGACCCTGATGC AGG (reversed) Intergenic
No off target data available for this crispr