ID: 964874304

View in Genome Browser
Species Human (GRCh38)
Location 3:161348396-161348418
Sequence CTTTCTCAAGGCCATCATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964874304_964874306 -8 Left 964874304 3:161348396-161348418 CCTTAATGATGGCCTTGAGAAAG 0: 1
1: 0
2: 0
3: 20
4: 171
Right 964874306 3:161348411-161348433 TGAGAAAGACCCTGAGCCAGAGG 0: 1
1: 1
2: 13
3: 70
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964874304 Original CRISPR CTTTCTCAAGGCCATCATTA AGG (reversed) Intronic
901478568 1:9507783-9507805 CTGTCTCAAAGCGATCAGTAAGG + Intergenic
903571768 1:24311201-24311223 ATTTTTCAAGGCCATCAGTTTGG - Intergenic
907657606 1:56360071-56360093 CATTCTCAAAGCCATCATGAAGG + Intergenic
911335066 1:96572878-96572900 CATTCTCAAGGCCCACAGTAGGG - Intergenic
911579809 1:99621593-99621615 CGCTCTCAATGTCATCATTATGG + Intergenic
914582906 1:149034945-149034967 CCTTCTCAAGTCCCTCTTTAAGG - Intronic
914925370 1:151881461-151881483 CTTTCTAAAGTCCACCATTTAGG + Intronic
917226249 1:172787039-172787061 CTTTCTCTAGCTCATCTTTAAGG + Intergenic
919080876 1:192864428-192864450 CTTCCTCTAGGGCAACATTAAGG - Intergenic
919918969 1:202156987-202157009 CTTTCTCAAAGCCATCTCTCTGG + Intronic
921150708 1:212400279-212400301 CTTAACCAAGGCCATCATGAAGG - Intronic
922377945 1:224988284-224988306 CTTTATCCAGTCTATCATTAAGG + Intronic
924943369 1:248827599-248827621 CTTTCTCAGGGCGTTTATTAAGG - Intergenic
1065938503 10:30543059-30543081 CTTTCCCAAGCCCACCATGAAGG - Intergenic
1068033707 10:51734532-51734554 CCTTCTCAAGGCCTACATTTGGG - Intronic
1068073837 10:52229439-52229461 CCTCCTCAAAGCCATCATGAGGG - Intronic
1069007695 10:63336661-63336683 CTGTCTCAATGACATCATCAAGG + Intronic
1070377887 10:75851963-75851985 CCTTCTCAAGGCCATTCCTAAGG - Intronic
1070444390 10:76481400-76481422 CTTTTTTAAGGCCTTCTTTAGGG + Intronic
1070796551 10:79220199-79220221 CTTTCTCACTCCCATGATTAGGG - Intronic
1071640575 10:87303136-87303158 CTTTCTAATGGCCATCAGAATGG - Intergenic
1072151117 10:92684964-92684986 CTTTCTCCAGATCATCAATAAGG - Intergenic
1073163199 10:101419379-101419401 CTCTCACAAGGCCATAATCAAGG + Intronic
1073213721 10:101825032-101825054 CTTTCTCTGGGTCACCATTATGG - Intergenic
1074316376 10:112365075-112365097 CTCTCTGAAGGCCTTCATGATGG - Intergenic
1074715874 10:116218236-116218258 GTTTCTCAAGACCACCATTTAGG + Intronic
1075467943 10:122665499-122665521 CTATCCCAGGGCCATCATCATGG + Intergenic
1078597152 11:12697334-12697356 CTTTCTCAAGGAGACCAGTATGG + Intronic
1078668272 11:13343620-13343642 CTTTGTCAAGTCCATCACTGAGG - Intronic
1080046917 11:27818777-27818799 CTTTCTCCATGTCAGCATTAAGG - Intergenic
1080595561 11:33771650-33771672 GTTTGTCAAGGCCATGACTAAGG + Intronic
1087959484 11:104330553-104330575 CTTTCACAAGTCCTTTATTAAGG + Intergenic
1089736077 11:120551032-120551054 CCTTCTCAAGGCCTTCATTCTGG - Intronic
1093743451 12:22713502-22713524 CTTTCTTTAGGGCATCATCATGG + Intergenic
1095445559 12:42278792-42278814 CTTTATCCAGTCTATCATTATGG - Intronic
1099617146 12:84950560-84950582 CTTTATCAAGTTCACCATTATGG - Intergenic
1101114225 12:101516586-101516608 GTCTCTCAAGGCTATCATGAGGG + Intergenic
1102621215 12:114196286-114196308 CCTTTTCAAGGGAATCATTAAGG + Intergenic
1102709841 12:114916237-114916259 CTTCCTGAAGGCCAACATCATGG + Intergenic
1104241323 12:126992950-126992972 TTTTCTCTATGCCATGATTACGG - Intergenic
1104613356 12:130248303-130248325 ATTTTTCAAGGCCATCGATAAGG + Intergenic
1106759251 13:32851485-32851507 CTTTTTAAAGGCAATCATTACGG + Intergenic
1107399137 13:40051757-40051779 CTGTGTCAAGGCCATCCTTAGGG + Intergenic
1109319952 13:60798502-60798524 CTATCTCAACTCCGTCATTATGG + Intergenic
1113241974 13:108348039-108348061 GGTGCTCAAGGCCAACATTAAGG - Intergenic
1115158842 14:30369958-30369980 CTTCCTCTTAGCCATCATTAAGG + Intergenic
1116285389 14:42964785-42964807 CTCTTTCAAGGGCATAATTAAGG + Intergenic
1118339534 14:64882519-64882541 CGTTATCAAGGTCATCATTGTGG + Intergenic
1119432378 14:74576764-74576786 TTTCCTCAAGGGCCTCATTAAGG + Intronic
1121413995 14:93766330-93766352 CTTGCTCAAGGCCACCACCAAGG - Intronic
1121920864 14:97879900-97879922 CTTTGTGAAGGTCATCATGATGG - Intergenic
1123874061 15:24606230-24606252 CTTTCCAAAGGCCACCAATATGG - Intergenic
1123963461 15:25432018-25432040 CTTTCTAAAGAACAGCATTATGG + Intronic
1128954002 15:71920164-71920186 CTTTCTTAATTCCATCATTATGG + Intronic
1134187632 16:12097116-12097138 CTTCCTCAAGGGCTTCATAATGG - Intronic
1138145564 16:54606821-54606843 ACTGCTCAAGGCCATCATGAAGG + Intergenic
1138884908 16:61064875-61064897 CTTTATCCAGTCCATCATTATGG - Intergenic
1139606091 16:68019765-68019787 CTTTTTCAAGGCCAGTAATAGGG - Intronic
1140696280 16:77537285-77537307 GTTTCTCAAGTCCAGCACTATGG - Intergenic
1140855825 16:78976911-78976933 TTTTCTCAGGGCCATCAGAAAGG + Intronic
1145713962 17:27002032-27002054 CTTTCTCCAGCCCAGCAATAAGG + Intergenic
1145991836 17:29083871-29083893 CTTTCTAAAGGCAATCAATATGG - Intronic
1158949327 18:62477596-62477618 CTTTCTCAAGCCCTTCTATAAGG - Intergenic
1159902634 18:74061869-74061891 CTTTCACAAGGAGATAATTATGG - Intergenic
926023447 2:9517519-9517541 CTTTCTCAGTGCCATCATTTTGG - Intronic
926882500 2:17562508-17562530 CTGTCTTAATGCCATCATTAGGG - Intronic
930375577 2:50561788-50561810 CTTTCTAAATGCTATCATTGGGG - Intronic
932649081 2:73536010-73536032 TTTTTTCAATGCCATCATTGTGG - Intronic
936241185 2:110790051-110790073 CTTTAGCAATGCCATCTTTAGGG - Intronic
936484556 2:112915091-112915113 CTTTCTCAAGGCCACTCTGAAGG - Intronic
936910395 2:117585312-117585334 ATTTTACAAGGCCAGCATTATGG + Intergenic
938050389 2:128164585-128164607 CTTTCTCATGCCTATCAGTACGG + Intronic
939611656 2:144318059-144318081 CTTTCTGGAGGCCTTCAATAAGG - Intronic
940267680 2:151857021-151857043 TTTTCCCTAGGCCATCTTTAGGG - Intronic
942641207 2:178062458-178062480 CTTTCTAATGGCCACCTTTATGG - Intronic
944823021 2:203450465-203450487 CTTTTTCAAGGTCACTATTATGG - Intronic
945003979 2:205383498-205383520 CTTTCTCAAGCCCTTCAGTGTGG + Intronic
946779232 2:223175873-223175895 CTTTCTCAAAGCCAGGCTTATGG - Intronic
948288318 2:236804354-236804376 CTTTCTAAAGAGCATGATTAGGG - Intergenic
1172967104 20:38844634-38844656 CTTTATCAAGGACATTTTTAAGG + Intronic
1172975805 20:38904917-38904939 CATTCTCATGGTCATCATTTAGG + Intronic
1173250591 20:41362368-41362390 CCCTCTCAAGGCCATCCATACGG + Exonic
1183222558 22:36525618-36525640 CTTTCCCAAGGCCCTGATTGGGG + Intronic
949583917 3:5418501-5418523 CTTTATCCAGTCTATCATTATGG - Intergenic
949855068 3:8453784-8453806 CTTTCCCAAGGCCATAAAGATGG + Intergenic
949981218 3:9502774-9502796 CTTGCTCAAGGCCATCCTGCTGG - Intronic
950663035 3:14478592-14478614 CTTTCTCAAGGCTCTCCTTTGGG + Intronic
950695384 3:14697276-14697298 CTTTCTCTAGCTCATCTTTAAGG + Intronic
951104458 3:18726782-18726804 CTTACTCAAGTCCCTCATTCAGG + Intergenic
952022301 3:29038918-29038940 CTTTTTCAAGGCCAGCATGCTGG + Intergenic
955958154 3:64311622-64311644 CTTTCTAAAGGCCATATTTTTGG - Intronic
956408739 3:68956185-68956207 CTTTTTCAAAGGCATCATGATGG + Intergenic
957988004 3:87596047-87596069 CGTTCTCAAGGGCAGAATTAGGG + Intergenic
958006978 3:87824344-87824366 CATTTTAAAGGGCATCATTAGGG - Intergenic
959602407 3:108202493-108202515 CTTTCTCATGGCCACTCTTAGGG + Intronic
960137975 3:114124662-114124684 CTTCCTGAAGGCTATCATAAGGG + Intergenic
964753702 3:160075867-160075889 CTTTTTCAAGTCCATCTTTGTGG + Intergenic
964874304 3:161348396-161348418 CTTTCTCAAGGCCATCATTAAGG - Intronic
967507634 3:190270994-190271016 CTTTATCCAGTCTATCATTAAGG + Intergenic
967757573 3:193187407-193187429 CAGTCTGAAGGCCATGATTAGGG - Intergenic
969592360 4:8129214-8129236 CACTCTCAATGCCATCTTTAAGG + Intronic
970974767 4:22030765-22030787 CTTTTTCAGTGCCATCAATATGG + Intergenic
971084612 4:23258014-23258036 CTATCTCAAGCCCATCAGAATGG + Intergenic
972133235 4:35862221-35862243 CTGTCTGAAGGCCATGACTAAGG + Intergenic
972571098 4:40311181-40311203 CTCTCTCAAGGCCATGATAGTGG - Intergenic
972699251 4:41477923-41477945 ATTCCTCAAGTCCACCATTAAGG - Intronic
972983768 4:44738889-44738911 CTTTTTCTAGTCCATCTTTATGG + Intergenic
977001133 4:91504609-91504631 CTTTATCATTGACATCATTAAGG + Intronic
977388149 4:96371447-96371469 CTTTGAGAAAGCCATCATTAAGG - Intergenic
978474307 4:109108695-109108717 CTTTCTCCAATCCTTCATTAAGG + Intronic
980243349 4:130204034-130204056 CCCTTTCAAGGCCAGCATTAAGG - Intergenic
981798565 4:148629017-148629039 CTTTCTCAAGGCCCACACTTTGG + Intergenic
983013752 4:162582847-162582869 CTTTCCCAAGGCCAGGAATAGGG - Intergenic
983436851 4:167726165-167726187 CTGCCTCAAGGCCATCTTTAGGG - Intergenic
984690178 4:182717466-182717488 CTTTGTCAGGGCCCTTATTACGG - Intronic
986780052 5:11057131-11057153 CTATCTCAAGACCAACATTCTGG + Intronic
987848552 5:23319451-23319473 ATATCTCAAGGCCACCAATAAGG + Intergenic
987869703 5:23599560-23599582 CTTTATCCAGTCTATCATTATGG + Intergenic
987922724 5:24304993-24305015 ATTTCTCTATGCCATTATTAAGG + Intergenic
988416742 5:30955037-30955059 CTATCACAAGCCCATCATGAGGG - Intergenic
988695138 5:33614307-33614329 CATTGTCAAGGCCATCTTTCTGG + Exonic
989472580 5:41837525-41837547 CTTTCTCAAAGACATCTCTAAGG + Intronic
989707697 5:44357509-44357531 CTCACTCAAGGCTATCATGATGG - Intronic
989779850 5:45250759-45250781 CATTTTAAAGGCCATAATTAAGG + Intergenic
990089846 5:52029492-52029514 CTTTATCCAGTCTATCATTATGG + Intronic
991130341 5:63115584-63115606 CTTTCTCAAGGCAATAGTTAAGG + Intergenic
993034259 5:82739811-82739833 CTTTCTCTTGTCCATCATTTAGG - Intergenic
994067807 5:95562814-95562836 TTTTCTCAAGGCCATTCCTATGG - Intronic
994725092 5:103425789-103425811 CCTGCTCAAGGTCATCGTTAAGG + Intergenic
995246275 5:109939016-109939038 CTTTCTCAAGGCTGCCATTAAGG + Intergenic
997860301 5:137409700-137409722 CTTTCTCAACCCAATCATTGTGG - Intronic
998246613 5:140512288-140512310 CTTTCTAAATGCCATTATCAAGG - Intronic
998268123 5:140681734-140681756 CTTTCTGAAGGCCATAAGGAAGG - Intronic
998690391 5:144581210-144581232 CATTTTCAGGGCCATCATTTTGG - Intergenic
999026458 5:148237683-148237705 TCTTCTCAAGGACATCACTATGG - Intergenic
999071935 5:148752618-148752640 CTTTATCCAGTCTATCATTAAGG + Intergenic
999715490 5:154356741-154356763 CTTTCTAAGGTCCCTCATTAGGG + Intronic
999975600 5:156908999-156909021 CTTTCTGAATGCCACCAATATGG - Intergenic
1003419415 6:5942435-5942457 CTTCCCAAAGGCCATCATGATGG + Intergenic
1004860069 6:19794904-19794926 TTTTCTTAAGACCAGCATTATGG + Intergenic
1005186172 6:23165186-23165208 AGTTCTCAAGGCCAATATTAAGG - Intergenic
1008255021 6:49287731-49287753 CTTTCTCCATGTCATCAATAAGG + Intergenic
1008904577 6:56662159-56662181 CTTTCTCAAAGGCATCATGGAGG + Intronic
1009595358 6:65728692-65728714 CTTTCTCAACCCCACCATTTTGG - Intergenic
1014480757 6:121933946-121933968 TTCTCTCAAAGCCATCATCATGG + Intergenic
1016077150 6:139809648-139809670 CTTTATCCAGTCCATCGTTATGG - Intergenic
1016117803 6:140310029-140310051 TTTTCTCAAGAGTATCATTATGG - Intergenic
1016732765 6:147444095-147444117 ATTTCTCAAGGCATTCTTTAAGG - Intergenic
1017591191 6:155979541-155979563 GTCTCTCAAGGCCAACATCAAGG - Intergenic
1019502533 7:1371570-1371592 CTTTCTTAGTGCCATCATGATGG - Intergenic
1021401400 7:20213532-20213554 CTTTATCCAGTCCATCATTATGG - Intronic
1021404819 7:20252836-20252858 CATTGCCAAGGCCAACATTAAGG - Intergenic
1021626000 7:22593685-22593707 CTTTATCCAGTCTATCATTATGG + Intronic
1024097638 7:45997065-45997087 TTTTCTCAATTCCTTCATTATGG - Intergenic
1025286590 7:57667391-57667413 CTTTCTCAAGCCCAGGATTCAGG - Intergenic
1026105931 7:67420800-67420822 CTTTCTGAAGGTCAACATTGGGG + Intergenic
1031637111 7:124115136-124115158 CTTTCTCAAGAGCTTCACTATGG + Intergenic
1031665806 7:124480966-124480988 CATTCTCGGGGCCATCATTCTGG + Intergenic
1032077255 7:128842024-128842046 CTGACTCAAGGCCATCTGTATGG - Intronic
1034850081 7:154485292-154485314 ATTTCTTAAGGACTTCATTAAGG - Intronic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1038972718 8:32654957-32654979 CTTGCTCAAGGCCATGAAGAGGG - Intronic
1039445278 8:37626207-37626229 CTTTCTCAAGCCCCTGATTCTGG + Intergenic
1042756776 8:72223029-72223051 CTTTCTCAGGGTCATAAATATGG - Intergenic
1043576367 8:81663284-81663306 TTCTCTCAAGGGCATCATTCTGG + Intronic
1044619547 8:94175648-94175670 CTTCATTAAGGCCTTCATTAAGG - Intronic
1048859327 8:138712231-138712253 CATACTCCAGGCCAGCATTATGG + Intronic
1051057223 9:13001806-13001828 CTTTCTCAAGGTCAATATTCAGG + Intergenic
1052099571 9:24428815-24428837 CCTACTCAAGGACATCATTACGG + Intergenic
1052688745 9:31787810-31787832 CTTTCTCCATACCAGCATTAAGG - Intergenic
1053117117 9:35514786-35514808 CTATCTCTAGGCCATCCTTATGG + Intronic
1053184788 9:36006386-36006408 CTTTCACAAGGCTATAACTAAGG - Intergenic
1056086742 9:83156983-83157005 CTTTCTCAAGGACAGCATGGAGG + Intergenic
1059247788 9:112863143-112863165 CTTTCTCATTGGCATCATTCTGG + Intronic
1060735068 9:126061553-126061575 CTTGCTGAAGACCCTCATTACGG - Intergenic
1060894285 9:127207790-127207812 CTTTCTCCAGGCCAGCCTTTAGG - Intronic
1062304879 9:135899908-135899930 CCTCCTCAAGCCCGTCATTATGG + Intronic
1185746748 X:2579508-2579530 TTTTCTCAAGCTGATCATTAAGG - Intergenic
1185996410 X:4954912-4954934 TTTTCTCATGGCCAGCATAAAGG - Intergenic
1186657866 X:11634881-11634903 CTTTCACAAAGCCATGATCAAGG + Intronic
1186886665 X:13921210-13921232 CTTTCTGAAGGGCATCTTTCAGG - Intronic
1186913098 X:14190849-14190871 ACTGCTCAAGGCCATCATCAAGG + Intergenic
1187292051 X:17964053-17964075 CTTTATCCAGTCCACCATTATGG + Intergenic
1188525920 X:31087749-31087771 CTTGCTCAAGGCCAGGAATAGGG + Intergenic
1189290137 X:39878989-39879011 CTTTCTCAAAGCCAGCATTCTGG + Intergenic
1189486149 X:41433843-41433865 GATTCTCAAGGCCATCTCTAAGG + Intergenic
1190791130 X:53701351-53701373 GTTTCACAAGGCCATAATCAAGG - Intergenic
1190853930 X:54274510-54274532 TCTTCTCAAGGACATCACTACGG + Intronic
1191646784 X:63489925-63489947 CTTTCTCAATGACCTCTTTAAGG - Intergenic
1193578259 X:83230878-83230900 CTGACTCAAGGCCTTCATTAGGG + Intergenic
1197002796 X:121458330-121458352 CTTTCTCATGTCTATCATTAAGG - Intergenic
1200405107 Y:2802139-2802161 CTTTATCAAGTCTATCATTATGG + Intergenic