ID: 964874491

View in Genome Browser
Species Human (GRCh38)
Location 3:161350802-161350824
Sequence TAAGCCCTGCTTCAGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964874491 Original CRISPR TAAGCCCTGCTTCAGCCAGG TGG Intronic
900462294 1:2807484-2807506 TGGGCCCTGCTTCAGCCTGCGGG - Intergenic
900505173 1:3026748-3026770 TTGACCCTGCTTCAGCCTGGAGG + Intergenic
902656847 1:17875008-17875030 TGAGGCCTGCTTCAGCAATGAGG + Intergenic
903226838 1:21898652-21898674 TCAGGCCTGCTCCAGCCAGTGGG - Intronic
903571415 1:24308442-24308464 TAAGCCCTGCTTGAACCCTGAGG - Intergenic
904496930 1:30892324-30892346 GAAGCCCAGCTTCTGCCAGTAGG + Intronic
904833186 1:33318724-33318746 CAAGGCCAGCTTCAGACAGGAGG - Intronic
905014010 1:34764735-34764757 TAAGAACTGCTTCAGCCATCAGG + Intronic
905187139 1:36204620-36204642 TAAGCCATGCTAGAGCCAGGGGG - Intergenic
905482700 1:38272315-38272337 TAAGGCTTGTCTCAGCCAGGGGG - Intergenic
905483154 1:38275388-38275410 GCAGCCCTGCTTCAGCCACTGGG - Intergenic
906319986 1:44809772-44809794 TCAGCCCTCCTCCAGACAGGAGG - Intronic
907297142 1:53462452-53462474 TCACTCCTGCTTCAGCCTGGCGG + Intronic
909490459 1:76220646-76220668 TAAACCCTACTTCATTCAGGAGG - Intronic
910750034 1:90619434-90619456 TAAGCACTACCTCAGCCAGGTGG + Intergenic
912411474 1:109483540-109483562 TAAGCCGTGCGTCCGCCAGCTGG - Intronic
912681880 1:111734024-111734046 AAAGCCCTGCTTTTGCCAAGTGG + Intronic
913290680 1:117268965-117268987 AAAGCCCAGCTTCAGCCAGGAGG + Intergenic
914725974 1:150328172-150328194 TAGACCCTGCTTCTGGCAGGTGG + Intronic
914921391 1:151849962-151849984 TCAGCCATGCTTCAGAAAGGAGG + Intronic
914933697 1:151959404-151959426 TAAGCCCTGTTGTAACCAGGTGG - Intergenic
916280714 1:163048234-163048256 TAAGCCCTCCTTAAGTAAGGCGG + Intergenic
919211962 1:194498359-194498381 CAAGCCCTGATTCATGCAGGTGG - Intergenic
920422424 1:205844168-205844190 TCAGCCCTGCTACAGTCAAGGGG - Exonic
921161001 1:212472113-212472135 TGAGCCCTGGATCAGCCTGGAGG - Intergenic
1063009631 10:2009812-2009834 TGAGCCCTGCTTCTTCCTGGTGG + Intergenic
1063456058 10:6183444-6183466 CAAGCCCAGCTTCAGGCTGGTGG - Intronic
1064220906 10:13439765-13439787 TGCTCCCTGCTTCAGCCAGGCGG + Intronic
1067852252 10:49761589-49761611 TAGGGCCTGCTTGAGCCAGGTGG + Intronic
1069751343 10:70747289-70747311 TATGCCCTGATTCATCCATGAGG + Intronic
1069991824 10:72320975-72320997 CAAGCCTTGCATCAGCCAGATGG - Intergenic
1070157154 10:73842350-73842372 AGAGCCCAGCTCCAGCCAGGAGG + Intronic
1070782742 10:79147050-79147072 TCAGGCCAGCTGCAGCCAGGAGG + Intronic
1071488363 10:86118686-86118708 CAAACACTGCCTCAGCCAGGTGG + Intronic
1075935306 10:126335757-126335779 CAAACCCTGCTTTAGCCAGATGG + Intronic
1076411513 10:130254858-130254880 AAAGCCCTGCTGCCCCCAGGTGG - Intergenic
1076579171 10:131495421-131495443 AAAGCATTGCTTCTGCCAGGTGG + Intergenic
1079375632 11:19889190-19889212 TAAGCCCGGACTCACCCAGGAGG - Intronic
1080820101 11:35797507-35797529 CAAGCACTACCTCAGCCAGGTGG + Intronic
1084571356 11:69961943-69961965 ACAGCCCTGCCTCAGCCAGAAGG + Intergenic
1085090393 11:73707315-73707337 TAAGGCCTGCTCTTGCCAGGTGG + Intronic
1087765734 11:102151248-102151270 TAAGCCCTTTTTCAGCCAGTGGG + Intronic
1088526447 11:110761399-110761421 TTATCCCTGTTTCAGCCATGGGG + Intergenic
1089999962 11:122947983-122948005 TAAACACTGCCTCAGCCACGTGG - Intronic
1090538388 11:127672134-127672156 CAAACACTGTTTCAGCCAGGTGG + Intergenic
1090550758 11:127817399-127817421 TAAGCAGTGATTAAGCCAGGAGG + Intergenic
1090879812 11:130823677-130823699 TGAGTCCAGCTGCAGCCAGGGGG - Intergenic
1091304967 11:134530992-134531014 TCAGCCCTCCTTCAGCCTCGGGG - Intergenic
1091409042 12:227297-227319 TAACCTCTACATCAGCCAGGAGG + Intronic
1091675508 12:2486231-2486253 CAAGACCTGCTACAACCAGGAGG + Exonic
1092287469 12:7137030-7137052 TACGCCATGCTTCATCCAGAAGG - Exonic
1093684892 12:22044944-22044966 TAAACCCTGATCCAGCCAAGAGG - Intergenic
1095982148 12:47979862-47979884 TAAGCCCACCCACAGCCAGGTGG - Intronic
1100438116 12:94590585-94590607 TAAGCCCTGGATCTGCCTGGAGG + Intronic
1101331734 12:103762614-103762636 CAAGCCCTGTCTCAGCCAGAAGG - Intronic
1101757421 12:107631850-107631872 CAAACACTGCCTCAGCCAGGTGG - Intronic
1103245814 12:119456262-119456284 AAAGCCCTGGGGCAGCCAGGTGG + Intronic
1103927061 12:124429082-124429104 CCGGCCCTGCTCCAGCCAGGAGG + Intronic
1105785557 13:23745806-23745828 TAATCCCAGCTACAGTCAGGAGG + Intronic
1106434290 13:29710157-29710179 CAAGCCTTGCTGCATCCAGGAGG - Intergenic
1108582594 13:51839624-51839646 TAAGCCCTAGTTCACCCAGGAGG - Intergenic
1108976457 13:56450197-56450219 TAAGCACTACCTAAGCCAGGTGG - Intergenic
1109406570 13:61908061-61908083 TAAGCCCTGCTTGAGGAGGGAGG + Intergenic
1109831146 13:67790725-67790747 TAAGCTCTGCTTTAGTCTGGTGG - Intergenic
1113165696 13:107439260-107439282 TAACCCCAACATCAGCCAGGTGG - Intronic
1121814001 14:96915205-96915227 TCAGTCCTGCTCCAGCCATGAGG + Intronic
1123488112 15:20759032-20759054 TGTCCCCTCCTTCAGCCAGGAGG + Intergenic
1123544612 15:21328105-21328127 TGTCCCCTCCTTCAGCCAGGAGG + Intergenic
1124095013 15:26641336-26641358 GAAGGCTTGCTTCAGCCAGCTGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1128729473 15:70011012-70011034 TAAGCCCTGGATCTGCCAGCTGG + Intergenic
1128750811 15:70147807-70147829 ACTGCCCTTCTTCAGCCAGGGGG - Intergenic
1131033155 15:89203409-89203431 CAAGCACTGGCTCAGCCAGGAGG + Intergenic
1131357617 15:91759075-91759097 TAAGCCTTGCTTCTGACAGTAGG + Intergenic
1202952955 15_KI270727v1_random:55376-55398 TGTCCCCTCCTTCAGCCAGGAGG + Intergenic
1132828558 16:1916812-1916834 TAATCCCTGCTGCAGGGAGGAGG - Intronic
1133168032 16:3962597-3962619 TGAGCACTGCTTCAGAGAGGAGG - Intronic
1136479350 16:30532280-30532302 TCAGCCCTGCCTCAGCAAAGGGG + Exonic
1136993790 16:35173793-35173815 CCAGCCCTGCTTCAGCCCGGCGG - Intergenic
1139229896 16:65273538-65273560 TAGGCCCTGCTTAGGCCAGGTGG + Intergenic
1140804621 16:78521492-78521514 TTAGCCCAGCTTCACACAGGTGG - Intronic
1145062499 17:19741967-19741989 TAAGGACTGCTGCAGCCAGCAGG + Intronic
1146572065 17:33961491-33961513 GCAGCTCAGCTTCAGCCAGGTGG - Intronic
1148768102 17:50051184-50051206 TCAGCCCTGACTCAGCCATGTGG + Intergenic
1150381039 17:64719687-64719709 GAAGGACTGCTTAAGCCAGGAGG + Intergenic
1152032808 17:77854444-77854466 GAACCCCAGCTTCAGCCAGGGGG + Intergenic
1153815387 18:8786070-8786092 CCAGACCTGCTTCAGCCTGGAGG + Exonic
1154169009 18:12037382-12037404 TAAGTCCTGTTTCAGGCATGTGG + Intergenic
1155095529 18:22551590-22551612 TGAGCAGTGGTTCAGCCAGGAGG - Intergenic
1157913526 18:51641694-51641716 TTAGCCCAGCTTCAACAAGGGGG + Intergenic
1160317111 18:77858629-77858651 AAAGCCCTGCCTCAGCCCAGGGG - Intergenic
1162451332 19:10756942-10756964 TCTGCCCTGCATCAGCCAGAGGG + Intronic
1162664018 19:12194856-12194878 GAAACCCTGCTTCAGTCCGGGGG - Intergenic
1162804342 19:13129280-13129302 CCACCCCTGCTTCAGCCAGCAGG + Intronic
1164563126 19:29307852-29307874 TGAGCTCTGCTTCAGCCAAATGG - Intergenic
1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG + Intergenic
1165227903 19:34366990-34367012 AAAGCCCTGCTACAAGCAGGAGG - Intronic
1166261117 19:41641774-41641796 TAAGATTTGCTTCAGTCAGGAGG + Intronic
1167067218 19:47195579-47195601 TAAAGCCTGCTTTAGCCAGAAGG - Intronic
1167797950 19:51722532-51722554 TAAGACCTGCTGCAGCCTGCAGG + Intronic
925742164 2:7015455-7015477 TCAGGCCTGCTCCAGCCAGAAGG - Intronic
926762989 2:16295956-16295978 CAAGCTCAACTTCAGCCAGGGGG - Intergenic
927119114 2:19937921-19937943 GAAGAGCTGCTTCAGCCAGTAGG + Exonic
927828027 2:26323222-26323244 TAAGACCTGATTCAGCCTGTGGG - Intronic
927946720 2:27139135-27139157 TCAGTCCTCCTTTAGCCAGGCGG + Intronic
928914907 2:36460131-36460153 TAACCACAGCTGCAGCCAGGTGG - Intronic
930477983 2:51909192-51909214 TAAGCCCTCTTTCTGCAAGGTGG - Intergenic
931799515 2:65745199-65745221 AAAGCCCTGCTCTAGCCATGAGG - Intergenic
945805447 2:214484531-214484553 TGATCACTGCTTCAGCCAGCTGG - Intronic
1173624910 20:44465727-44465749 TCAGGCCTGCTTCAGGGAGGTGG + Intergenic
1174460403 20:50678371-50678393 TAGGCCCTCCCTGAGCCAGGTGG - Intronic
1174531272 20:51216348-51216370 TGTGCCCTGCTTCAGCCAGTAGG - Intergenic
1175763991 20:61580668-61580690 GGATCCCTGCTTCAGCCAGCAGG - Intronic
1176450225 21:6855561-6855583 TGTCCCCTCCTTCAGCCAGGAGG - Intergenic
1176828394 21:13720579-13720601 TGTCCCCTCCTTCAGCCAGGAGG - Intergenic
1181793684 22:25287611-25287633 AAAGCTCTGCTTTAGCCATGTGG + Intergenic
1181833681 22:25584155-25584177 AAAGCTCTGCTTTAGCCATGTGG + Intronic
1184373393 22:44096980-44097002 CAAGCGCTGCTCCATCCAGGGGG - Intronic
949789120 3:7773371-7773393 TAAGCCCTGCATAAGCCACAAGG - Intergenic
953111519 3:39945061-39945083 TGAGCCCTGTTTCACCCAAGAGG + Intronic
953331684 3:42058675-42058697 AGATCCCTGCATCAGCCAGGAGG - Intronic
954214503 3:49116971-49116993 TCAGCCCTGGGTCTGCCAGGTGG + Intronic
954663962 3:52240676-52240698 TGAACCCTGCTACAGCCAGATGG + Intergenic
954808829 3:53235626-53235648 CAAGCTCTGCTTCTGCCCGGAGG + Intronic
955798207 3:62659758-62659780 TGAGCTCTTCTTCACCCAGGTGG - Intronic
956530824 3:70216717-70216739 GAAGGCCTGCCTCACCCAGGAGG - Intergenic
957375456 3:79350974-79350996 TATGCACTGCTGCACCCAGGAGG + Intronic
958757831 3:98271628-98271650 TAGGCACTGGTTCAGCCATGGGG - Intergenic
959984604 3:112558856-112558878 TAATCCCAGCTACAGGCAGGAGG - Intronic
961740071 3:129027511-129027533 GAAGCCCTGCAGCACCCAGGAGG - Intronic
964665888 3:159171544-159171566 TCAGCCCTGCTTCAGACTAGTGG + Intronic
964874491 3:161350802-161350824 TAAGCCCTGCTTCAGCCAGGTGG + Intronic
966988198 3:185201519-185201541 TAAGCCGGGTTTCAGTCAGGAGG + Intronic
969919971 4:10529135-10529157 TAAGAACTGCTTTAACCAGGGGG + Intronic
973711051 4:53630939-53630961 TAAGCCCTGATCCACCCTGGTGG - Intronic
978640106 4:110860689-110860711 TAAGCCATCGTTCAGGCAGGTGG + Intergenic
979931767 4:126640801-126640823 GGAGCCCTGCTTCTCCCAGGAGG - Intergenic
980103760 4:128567228-128567250 AAAGTCCTGCTTCATTCAGGAGG + Intergenic
980966732 4:139528809-139528831 TAAGCCCAGCCTCAGCCAGCTGG + Intronic
986048599 5:4065435-4065457 TAATTTCTGCTCCAGCCAGGAGG + Intergenic
986069192 5:4265529-4265551 CCAGCCCTGCTTCAGCCACATGG - Intergenic
986717297 5:10533482-10533504 TCAGCCCTGCGTTAGCCAGCGGG - Intergenic
992986346 5:82234371-82234393 TAAGCCCTGCTTCTGCAGGGTGG - Intronic
994992969 5:107020983-107021005 TAAACACTACTTCAGCCAGAGGG - Intergenic
995534858 5:113124931-113124953 TGAGCGCTGCTCCACCCAGGAGG - Intronic
997827977 5:137124519-137124541 TAAGGACTGCCTCAGCCATGAGG - Intronic
998360806 5:141585074-141585096 TAATCCCAGCTACTGCCAGGAGG - Intronic
1000419032 5:161015942-161015964 GAAGCCCTGCTTCAGGCTGCAGG + Intergenic
1001407674 5:171487319-171487341 AAAGCCCTTCTTCCCCCAGGAGG - Intergenic
1001523451 5:172412228-172412250 ACAGCCCTGCTACAGCCACGGGG - Intronic
1001996346 5:176162544-176162566 TAAAGGCTGCTTCAGCCAGTGGG - Intergenic
1002598165 5:180337661-180337683 TCAGCCCTGCCTCAGTGAGGTGG - Intronic
1003540774 6:7016355-7016377 TAATTCCTGTTTCTGCCAGGAGG + Intergenic
1004180790 6:13378981-13379003 AAACCCCTCCTGCAGCCAGGAGG + Intronic
1005105013 6:22214650-22214672 AAGGCCCTGCTTCAGGCTGGGGG + Intergenic
1005779119 6:29169672-29169694 TAAGTCCTGCTTCTGGCATGAGG + Intergenic
1006172164 6:32099562-32099584 CAAGTCCAGCTTCAACCAGGGGG - Intronic
1007636189 6:43301237-43301259 TGAGGACAGCTTCAGCCAGGAGG + Exonic
1009482104 6:64171943-64171965 TGAGCCTTTCTTCAGGCAGGAGG + Intronic
1011571234 6:88738052-88738074 CAAACCCTACTTTAGCCAGGTGG + Intronic
1012552191 6:100473739-100473761 TGAGCCCTGAATCAGCAAGGAGG - Intergenic
1016503487 6:144749402-144749424 TAAGCCCTTCTCCTGCCAGAAGG - Intronic
1016727118 6:147384770-147384792 TAAGTCCAACTTCAGCCAGAAGG + Intronic
1016982584 6:149866377-149866399 TGACATCTGCTTCAGCCAGGAGG + Intergenic
1017370719 6:153703912-153703934 CAAACACTACTTCAGCCAGGTGG - Intergenic
1019319091 7:407183-407205 CAACCCCTGCTACAGCCTGGAGG + Intergenic
1021154790 7:17196532-17196554 TGTTCCCTGCTTCAGCCAGAGGG + Intergenic
1022500828 7:30881534-30881556 CAAGTCCTGCTTCATCCATGAGG + Intronic
1025713385 7:63931608-63931630 CCAGCCCTGCTTCAGCGCGGGGG - Intergenic
1028808784 7:95060317-95060339 TCAGCCATGCTTTAGCAAGGGGG + Intronic
1029677105 7:102077342-102077364 CAAGCCCTGCAGCAGCCAGACGG + Intronic
1033400778 7:141022096-141022118 TTAGTCCTGCTTCAGCTATGTGG + Intergenic
1039901369 8:41755105-41755127 TCAGCCCTGCTTCAGGCTGAGGG - Intronic
1039920012 8:41886884-41886906 TACTCCCTTCTGCAGCCAGGGGG - Intronic
1041088113 8:54275567-54275589 CAAACACTACTTCAGCCAGGTGG - Intergenic
1042834595 8:73067796-73067818 TAATCCCAGCGTGAGCCAGGAGG - Intronic
1043166300 8:76907253-76907275 TGATCCCAGCCTCAGCCAGGCGG + Intergenic
1050123971 9:2337302-2337324 TAAACACTCCTTGAGCCAGGAGG - Intergenic
1051482407 9:17574866-17574888 TTAGCCCTGCCTGAGCTAGGTGG + Intergenic
1057469666 9:95346214-95346236 TGAGCCCTGCTTCAGTGAGCTGG - Intergenic
1058678586 9:107422372-107422394 GAAGCCCTGCTTCCTCCAGAGGG + Intergenic
1060660573 9:125402849-125402871 TAATCCCAGCTACTGCCAGGAGG - Intergenic
1061285108 9:129618185-129618207 TCACCCCTGCTTAAGCCTGGAGG + Intronic
1061838057 9:133342204-133342226 ATAGCCCTACATCAGCCAGGCGG + Intronic
1203518957 Un_GL000213v1:28956-28978 TGTCCCCTCCTTCAGCCAGGAGG + Intergenic
1187902067 X:24034691-24034713 TGAGCCCAGCTGCAGCCACGTGG - Intergenic
1190248140 X:48704353-48704375 TAGGCCCTCCTTGAGCCAGGAGG - Intronic
1191204517 X:57820198-57820220 TAACCCCTGATTCAGTCAAGGGG - Intergenic
1195458590 X:105098215-105098237 TAAGCTGTGCTTTAGCAAGGAGG - Intronic
1195515167 X:105765901-105765923 TAAGCACTGCTTCTGCTAGAGGG + Intronic
1198724775 X:139665363-139665385 TCAGGCCAGCTTCAGCCAGAGGG - Intronic
1199232160 X:145448806-145448828 TCCACCCTGCTTCAGCCATGGGG - Intergenic
1201282789 Y:12355727-12355749 TTAGCCCTGCTTGAAGCAGGTGG - Intergenic