ID: 964878403

View in Genome Browser
Species Human (GRCh38)
Location 3:161395789-161395811
Sequence GAAAACAAGGAGAAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964878398_964878403 -5 Left 964878398 3:161395771-161395793 CCCAACGTTTCACAACCAGAAAA No data
Right 964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG No data
964878397_964878403 -1 Left 964878397 3:161395767-161395789 CCTGCCCAACGTTTCACAACCAG No data
Right 964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG No data
964878399_964878403 -6 Left 964878399 3:161395772-161395794 CCAACGTTTCACAACCAGAAAAC No data
Right 964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964878403 Original CRISPR GAAAACAAGGAGAAGGAGCC AGG Intergenic
No off target data available for this crispr