ID: 964879130

View in Genome Browser
Species Human (GRCh38)
Location 3:161404233-161404255
Sequence GTGCAGAGCTTCACTTATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964879130_964879134 17 Left 964879130 3:161404233-161404255 CCCTTATAAGTGAAGCTCTGCAC No data
Right 964879134 3:161404273-161404295 GAGAATCCCCATCAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964879130 Original CRISPR GTGCAGAGCTTCACTTATAA GGG (reversed) Intergenic
No off target data available for this crispr