ID: 964879791

View in Genome Browser
Species Human (GRCh38)
Location 3:161410710-161410732
Sequence CCTCAGAGGGAGAGAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964879782_964879791 30 Left 964879782 3:161410657-161410679 CCAGACATATAAATACACCCATG No data
Right 964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG No data
964879783_964879791 13 Left 964879783 3:161410674-161410696 CCCATGATGTCATCATCACATAA No data
Right 964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG No data
964879784_964879791 12 Left 964879784 3:161410675-161410697 CCATGATGTCATCATCACATAAA No data
Right 964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964879791 Original CRISPR CCTCAGAGGGAGAGAGTGGG AGG Intergenic
No off target data available for this crispr