ID: 964881499

View in Genome Browser
Species Human (GRCh38)
Location 3:161428356-161428378
Sequence CTGTGGAAGGCTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964881499_964881504 -8 Left 964881499 3:161428356-161428378 CCTTCCACCTCAGCCTTCCACAG No data
Right 964881504 3:161428371-161428393 TTCCACAGTGCTAGGATTACAGG 0: 7
1: 1260
2: 37086
3: 334400
4: 250984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964881499 Original CRISPR CTGTGGAAGGCTGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr