ID: 964881504

View in Genome Browser
Species Human (GRCh38)
Location 3:161428371-161428393
Sequence TTCCACAGTGCTAGGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 623737
Summary {0: 7, 1: 1260, 2: 37086, 3: 334400, 4: 250984}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964881499_964881504 -8 Left 964881499 3:161428356-161428378 CCTTCCACCTCAGCCTTCCACAG No data
Right 964881504 3:161428371-161428393 TTCCACAGTGCTAGGATTACAGG 0: 7
1: 1260
2: 37086
3: 334400
4: 250984
964881497_964881504 17 Left 964881497 3:161428331-161428353 CCTCAAACTCCTGGGCTCAAATG 0: 162
1: 2584
2: 9019
3: 21708
4: 45460
Right 964881504 3:161428371-161428393 TTCCACAGTGCTAGGATTACAGG 0: 7
1: 1260
2: 37086
3: 334400
4: 250984
964881498_964881504 8 Left 964881498 3:161428340-161428362 CCTGGGCTCAAATGATCCTTCCA 0: 49
1: 1440
2: 12752
3: 36117
4: 72725
Right 964881504 3:161428371-161428393 TTCCACAGTGCTAGGATTACAGG 0: 7
1: 1260
2: 37086
3: 334400
4: 250984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964881504 Original CRISPR TTCCACAGTGCTAGGATTAC AGG Intergenic
Too many off-targets to display for this crispr