ID: 964886250

View in Genome Browser
Species Human (GRCh38)
Location 3:161486497-161486519
Sequence GGTTGTGGAGACATGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964886245_964886250 7 Left 964886245 3:161486467-161486489 CCTAATCTGATCCTTAAAAGTTT No data
Right 964886250 3:161486497-161486519 GGTTGTGGAGACATGGAGCTAGG No data
964886247_964886250 -4 Left 964886247 3:161486478-161486500 CCTTAAAAGTTTCTTTAAAGGTT No data
Right 964886250 3:161486497-161486519 GGTTGTGGAGACATGGAGCTAGG No data
964886244_964886250 13 Left 964886244 3:161486461-161486483 CCTTTGCCTAATCTGATCCTTAA No data
Right 964886250 3:161486497-161486519 GGTTGTGGAGACATGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964886250 Original CRISPR GGTTGTGGAGACATGGAGCT AGG Intergenic
No off target data available for this crispr