ID: 964886708

View in Genome Browser
Species Human (GRCh38)
Location 3:161491853-161491875
Sequence CTGTGTTTAAATCGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964886703_964886708 19 Left 964886703 3:161491811-161491833 CCTTATCACAATCAAAGTGCTGC No data
Right 964886708 3:161491853-161491875 CTGTGTTTAAATCGGGAAGCAGG No data
964886704_964886708 -3 Left 964886704 3:161491833-161491855 CCAACATTATCCTTTAACATCTG No data
Right 964886708 3:161491853-161491875 CTGTGTTTAAATCGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964886708 Original CRISPR CTGTGTTTAAATCGGGAAGC AGG Intergenic
No off target data available for this crispr