ID: 964887301

View in Genome Browser
Species Human (GRCh38)
Location 3:161499204-161499226
Sequence CAGGGCCACCAGGAGTTGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964887288_964887301 20 Left 964887288 3:161499161-161499183 CCATTTCTAGGTCCTAAAGGAGA 0: 1
1: 0
2: 2
3: 18
4: 208
Right 964887301 3:161499204-161499226 CAGGGCCACCAGGAGTTGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 179
964887291_964887301 8 Left 964887291 3:161499173-161499195 CCTAAAGGAGAGGCTGGAAATTT 0: 1
1: 0
2: 1
3: 71
4: 318
Right 964887301 3:161499204-161499226 CAGGGCCACCAGGAGTTGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 179
964887287_964887301 21 Left 964887287 3:161499160-161499182 CCCATTTCTAGGTCCTAAAGGAG 0: 1
1: 0
2: 0
3: 14
4: 157
Right 964887301 3:161499204-161499226 CAGGGCCACCAGGAGTTGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964887301 Original CRISPR CAGGGCCACCAGGAGTTGTT GGG Exonic
903834070 1:26191351-26191373 CAGGGCCAGCAGCAGTTGGAAGG - Exonic
906516544 1:46442442-46442464 CAGCGCCACCTGGAGTTGAAAGG - Intergenic
906746096 1:48223170-48223192 CAGGGCAACCAGGGATGGTTGGG - Intronic
908990962 1:70088728-70088750 CAGGGTCTCCAGGAATTCTTAGG + Intronic
909486040 1:76175262-76175284 CACTGCCTCCAGGAGTTTTTTGG + Intronic
909949513 1:81703326-81703348 CAGGGGCAATTGGAGTTGTTAGG + Intronic
912453171 1:109779930-109779952 CAGGGCCACCTGGAGCTCTGAGG - Intergenic
917665651 1:177222881-177222903 CAGGGCCGCAAGGAGTGGCTGGG + Intronic
917665919 1:177225563-177225585 CAGTTCCACCAGAAGTTGTGAGG + Intronic
918090347 1:181287848-181287870 CAAGACTACCAGGATTTGTTTGG + Intergenic
920196161 1:204228650-204228672 CTGGGCCACTAGAAGTCGTTGGG - Intronic
922620367 1:226984846-226984868 CAGAGACACCAGGAGAAGTTTGG - Intronic
924567183 1:245208666-245208688 CAGCTCCACCTGGAGATGTTGGG - Intronic
1065623330 10:27606071-27606093 CAGGGTCACCCGAAGTTATTCGG - Intergenic
1067947727 10:50701018-50701040 CATGGGCTCCAGGTGTTGTTTGG - Intergenic
1070883042 10:79866011-79866033 CATGGGCTCCAGGTGTTGTTTGG - Intergenic
1071649612 10:87382326-87382348 CATGGGCTCCAGGTGTTGTTTGG - Intergenic
1076001065 10:126913418-126913440 CAGTGCCCCCTGGAGTTGTGTGG - Intronic
1076247290 10:128957400-128957422 CAGGGAGCCCAGGAGTTGCTGGG - Intergenic
1077058208 11:606201-606223 CAGGGAAACCAGGCGTTTTTGGG - Intronic
1077215115 11:1392140-1392162 AAGGGTCACCAGGAGTTGGGTGG + Intronic
1077430349 11:2513110-2513132 CTGGGCCACCAGGTCTTGTCTGG + Intronic
1078477926 11:11648903-11648925 CAAGGCCACCAGGCTCTGTTTGG - Intergenic
1078682740 11:13494272-13494294 CAGGGCCATCCTGAGCTGTTAGG - Intronic
1084063412 11:66689999-66690021 CAGGGCCTCCACGGGTTGTGTGG - Intronic
1085026708 11:73240550-73240572 CAGGGACCCCAGGGATTGTTTGG + Intergenic
1085260346 11:75200915-75200937 CAGGGCCAGCAGGCATTCTTAGG - Intronic
1089844284 11:121446308-121446330 CAGGGCCTCTAGGGGTAGTTGGG + Intergenic
1091409062 12:227405-227427 CAGGGCTACCAGGAGCTGCAAGG - Intronic
1094056223 12:26272297-26272319 CAGGGCTGCCAGGTGTGGTTGGG - Intronic
1098703050 12:73653214-73653236 CAGGGCTTCCAGGTGCTGTTAGG + Intergenic
1098721534 12:73905130-73905152 CAGGGCCAACAGGTGATGTCTGG - Intergenic
1098807125 12:75034264-75034286 AAGGCCCACCAGAAGCTGTTTGG + Intergenic
1100757297 12:97765544-97765566 CACAGTCATCAGGAGTTGTTTGG + Intergenic
1103561179 12:121793955-121793977 CAGGGGCACCTGGAGTCGCTGGG - Exonic
1105429951 13:20327229-20327251 CAGAGCTGCCAGAAGTTGTTAGG + Intergenic
1107302042 13:38976221-38976243 CAGGGCCACCAGGAGAATGTGGG - Intronic
1112789969 13:102992355-102992377 CAGAGCCAACAGGATTTGCTGGG + Intergenic
1113608967 13:111629802-111629824 CAGGGGCACCGGGAGGTGTGGGG - Intronic
1113748696 13:112764074-112764096 GAGTGTTACCAGGAGTTGTTAGG + Intronic
1113765802 13:112880484-112880506 CGGGGCCACCAGGAGTGCTCGGG - Intronic
1116324367 14:43513130-43513152 AAGAGCAACCAGGAGTTCTTGGG - Intergenic
1117495264 14:56296122-56296144 AAGGGTCACCAGGAGTGCTTTGG + Intronic
1118326807 14:64786792-64786814 CAGGGCCAGGAGGACTTGCTGGG - Exonic
1118862490 14:69675391-69675413 CAGGGCCAGGAGGAGGTGCTGGG - Intronic
1121530431 14:94649003-94649025 CAGGGGCAACAGGACTTGCTGGG + Intergenic
1121881355 14:97503171-97503193 CAGGACCACCAGGAGTGTTGGGG + Intergenic
1123152707 14:106198398-106198420 CAGGCCAACCAGGTATTGTTAGG + Intergenic
1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG + Intergenic
1125541806 15:40474032-40474054 CAGGCCCATCAGGAGTTGCTGGG + Exonic
1127628603 15:60804390-60804412 GTGGGCCTCCAGAAGTTGTTGGG - Intronic
1128345639 15:66850809-66850831 CAGGGCTGCCAGGAATGGTTGGG + Intergenic
1131175337 15:90205808-90205830 CAAGGCCCCCAGGAGCTGATTGG + Intronic
1132648483 16:1009933-1009955 CAGGGACACCAGGAGGGGCTGGG + Intergenic
1136399865 16:30011416-30011438 CAGGTCTCCCAGGAGTAGTTGGG - Intronic
1136513115 16:30751317-30751339 CAGGGCCAGCAGGAGGTGGGGGG - Intronic
1137068958 16:35881930-35881952 CAGGGGCAACAGCAGTTGCTAGG - Intergenic
1138511420 16:57510629-57510651 CAGGGTCACCAGGAGCTCTGGGG - Intergenic
1138693934 16:58793606-58793628 CAAGGCCAGCAGCAGTTGATGGG - Intergenic
1140280474 16:73550139-73550161 CAGGTCCCCCAGGAGTACTTCGG + Intergenic
1140610398 16:76592005-76592027 AATGGAAACCAGGAGTTGTTTGG + Intronic
1142150581 16:88510887-88510909 CAGGCCCAGCAGGACTTGTGAGG - Intronic
1142666973 17:1468757-1468779 CAGGGCCACCAGGGCCTGATGGG - Intronic
1143116010 17:4582256-4582278 CAGGGCCCCCAGGCCTTGGTGGG + Intergenic
1152438274 17:80289133-80289155 CAGTGCCCCCAGGAGGAGTTGGG + Intronic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1157477165 18:48030816-48030838 CAAGACCACCAGGAGGTGTGTGG - Intronic
1157619541 18:49008434-49008456 CAGGGCCACCAGCCATTTTTGGG - Intergenic
1159973882 18:74686357-74686379 CAGGAGCACCAGGAGTTATGGGG - Intronic
1160271917 18:77394577-77394599 CAGGGCAACCAGGTTTTTTTGGG - Intergenic
1161699523 19:5787243-5787265 CAGGGCCCGGGGGAGTTGTTTGG + Intronic
1161709350 19:5839053-5839075 CAGGGACACCAGGGGTTCCTTGG + Exonic
1162549517 19:11350867-11350889 CAGGGCCGGCAGGAGCTGTATGG + Exonic
1163175355 19:15560934-15560956 CAGGGCCCCCTGGAGTAGGTGGG - Intergenic
1163647675 19:18499201-18499223 AAGGGCCACCAGCAGCTGCTGGG + Intronic
1163928980 19:20370572-20370594 CAGGCCAACCAGGTATTGTTGGG - Intergenic
1165522071 19:36322425-36322447 GAAGGGCACAAGGAGTTGTTGGG - Intergenic
1165633736 19:37323119-37323141 GAGGGTCACAAGGAGTTGTTGGG + Intronic
1165900548 19:39167438-39167460 CAGGGCCACCAGGGGTGGGCTGG + Intronic
1166446832 19:42865429-42865451 CAGGTCCACCTGCAGTTATTTGG - Intronic
1166560474 19:43729436-43729458 CTGGGCCAGCAGGAGGTGGTAGG + Exonic
1167167758 19:47810815-47810837 ATGGGCAACAAGGAGTTGTTTGG + Intronic
1167242017 19:48349700-48349722 CAGGGCCACCCTGTGTGGTTGGG + Intronic
1167358317 19:49017140-49017162 CAAGGCCACCAGGAGGTGATAGG + Intergenic
1167359810 19:49024030-49024052 CAAGGCCACCAGGAGGTGATAGG + Exonic
1167363748 19:49044129-49044151 CAAGGCCACCAGGAGGTTGTAGG - Exonic
1167364749 19:49048798-49048820 CAAGGCCACCAGGAGGTTGTAGG + Exonic
1167366038 19:49055434-49055456 CAAGGCCACCAGGAGGTTGTAGG + Exonic
1167414513 19:49363037-49363059 CAGGACCACCGGGAGTTTATTGG + Intronic
932749095 2:74359922-74359944 AAGTGCCACCAGAAGTTGCTTGG + Intronic
932831756 2:74996912-74996934 CAGGGACACCAGGATTAGTGAGG - Intergenic
938955050 2:136289446-136289468 TAGGGCCTTTAGGAGTTGTTTGG - Intergenic
942784223 2:179682317-179682339 CAGGGCAAACAGGATTTGCTGGG + Intronic
943772798 2:191736877-191736899 CAGGGCCACTAGGAGCTGCCAGG + Intergenic
946174464 2:217913888-217913910 CAGGGTCACCAAGGGTTGTTTGG + Intronic
946881981 2:224185533-224185555 GAGGCCCACCACGAGGTGTTTGG - Intergenic
1168955709 20:1832823-1832845 CAGGGCCACCCGGAGCTGGAGGG + Intergenic
1170257729 20:14363864-14363886 TAGGACCACAAGGTGTTGTTGGG + Intronic
1171008428 20:21491331-21491353 CAGGGGCACCAGTAGCTTTTGGG - Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171242153 20:23580208-23580230 CAGGAACACCAGTAGTTTTTAGG + Intergenic
1173182628 20:40816233-40816255 GAGAGCCACCAGCAGTTGTTAGG - Intergenic
1174174551 20:48636592-48636614 CAGGGCCGCCAGCAGCTGCTTGG + Exonic
1174192331 20:48749274-48749296 CAGGGCCACGGGGAGCTGTGGGG + Intronic
1174340078 20:49890061-49890083 GAGGGGCCCCAGGATTTGTTGGG + Exonic
1174430035 20:50460924-50460946 CTGGGCCACCAGGAGGCGCTAGG - Intergenic
1174485886 20:50861033-50861055 CAGAGCCAACAGGATTTGCTGGG + Intronic
1174779103 20:53371971-53371993 GAGGGGCACCAGGGATTGTTGGG - Intronic
1174856182 20:54047551-54047573 CAGAGGCACAAGGAGCTGTTGGG + Intronic
1176448158 21:6840036-6840058 CAGGGCCACCGGGAGGCGGTCGG - Intergenic
1176826328 21:13705058-13705080 CAGGGCCACCGGGAGGCGGTCGG - Intergenic
1180254918 21:46620272-46620294 CAGAGCCACCTGGAGTAGGTAGG + Intergenic
1181972733 22:26704690-26704712 CAGGGCCAGCTGGAGGTGCTGGG + Intergenic
1181997047 22:26891424-26891446 AAGGGCTGCCAGGAGTTGGTGGG - Intergenic
1183953991 22:41368452-41368474 CAGGGCCACCTGGTGATGCTAGG - Intronic
1184388638 22:44190578-44190600 CAGGGCCACAAGGAGGTGCAGGG - Exonic
950479409 3:13235356-13235378 CGGGGCCAGCAGCAGTGGTTGGG - Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
952431972 3:33232422-33232444 TAGGGCCAACAGGAGATATTTGG - Intergenic
954266179 3:49471945-49471967 CAGGGCCAGCAGGAATTAGTGGG + Intronic
960597556 3:119420195-119420217 CAGTCCCACCAGGATTTATTTGG + Exonic
960687952 3:120312820-120312842 CAAGGCACACAGGAGTTGTTAGG - Intergenic
962374862 3:134851148-134851170 CAGGGCCAGCAGGCCTTGTCTGG + Intronic
963482959 3:145900213-145900235 CAGGGCCCCCAGGAGACCTTTGG - Intergenic
964506342 3:157404248-157404270 CAGGGCCACGAGGAGGTATAAGG + Intronic
964887301 3:161499204-161499226 CAGGGCCACCAGGAGTTGTTGGG + Exonic
965522098 3:169678373-169678395 CAGAGGCACCAGGAGTTCCTGGG + Intergenic
968047299 3:195631472-195631494 CAGGGCCACCAGGATGTCTATGG + Intergenic
968307314 3:197658452-197658474 CAGGGCCACCAGGATGTCTATGG - Intergenic
968392619 4:205515-205537 GCGGGCCACCAGGAGCTGCTTGG + Intergenic
969526176 4:7705232-7705254 CAGGGCCCCCAGGAGCTGGAAGG + Intronic
973550912 4:52035409-52035431 CAGGATGACCTGGAGTTGTTAGG + Intronic
976239753 4:82942735-82942757 CAGGACCACCAGGAAGTTTTTGG - Intronic
980946157 4:139322580-139322602 CATGAGCACCAGTAGTTGTTAGG + Intronic
981885154 4:149665601-149665623 CATGGCCAACTGGAGTTGCTTGG - Intergenic
985575843 5:673227-673249 CAGGGCCACCACGAGGCGTTGGG - Intronic
985695056 5:1335464-1335486 CCGGGGCACCAGGACTTGTGCGG - Intronic
986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG + Intergenic
992816335 5:80443547-80443569 CAGGAGCACCAGGAGGTGCTTGG + Intronic
996021139 5:118591999-118592021 TAGGGTCATCAGGAGTTTTTAGG - Intergenic
998080748 5:139273412-139273434 CAAGGCTACCAGGATTTCTTTGG - Intronic
999953180 5:156672018-156672040 CAGGGCCTAGAGGAGGTGTTTGG - Intronic
1002167597 5:177358089-177358111 CAGGGCCACGAGGAGGGGGTGGG + Intronic
1002581709 5:180212752-180212774 CAGGCCCACGAGGAGTTGGCAGG + Intergenic
1002636079 5:180609514-180609536 CAGGGCCACTTGGAGATGTTGGG - Intronic
1005738072 6:28767501-28767523 CAGGCCAACCAGGTATTGTTAGG + Intergenic
1006295924 6:33170071-33170093 AAGGTCCCCCAGGAGGTGTTGGG - Exonic
1007719117 6:43875044-43875066 CAAGGCCACCAAGAGGTGTCTGG - Intergenic
1009931355 6:70180328-70180350 CAGGGCCTCCAGGAGTTCCAGGG + Exonic
1011356881 6:86480356-86480378 CAGGCCAACCAGGTATTGTTAGG - Intergenic
1018098421 6:160414330-160414352 CAGTGTCACCAAGAGTTGATGGG - Intronic
1022705759 7:32800836-32800858 CAGGCCCACCAGCAGTTATCTGG + Intergenic
1024916592 7:54507270-54507292 CAGGCCTAGCAGGAGGTGTTTGG + Intergenic
1025177639 7:56810082-56810104 CAGGGCCACCGGGAGCTGGGCGG + Intergenic
1025244769 7:57308787-57308809 CCGGGCCACCAGGGGGTGCTAGG + Intergenic
1025694116 7:63766157-63766179 CAGGGCCACCGGGAGTTGGGCGG - Intergenic
1032097350 7:128946186-128946208 CAGGGCTTCCAGGAGTGGCTGGG + Intronic
1032153596 7:129450778-129450800 CAGGGCAGCCAGGAATTGTAGGG + Intronic
1036229564 8:6988227-6988249 CAGGGCCACCAGGAGAAGCATGG + Intergenic
1036232015 8:7007330-7007352 CAGGGCCACCAGGAGAAGCATGG + Intronic
1038779901 8:30561364-30561386 CAGTGCCATCTGGAGTTGTAAGG - Intronic
1040108255 8:43552607-43552629 CAAGCCAACCAGGTGTTGTTAGG + Intergenic
1041231440 8:55756961-55756983 CAGGGCATCCATGAGTTGTAGGG + Intronic
1043750290 8:83926228-83926250 CAGGGCCACCTCAACTTGTTGGG - Intergenic
1045052955 8:98343330-98343352 CAGTGGCACCTGGAGTGGTTCGG - Intergenic
1046099607 8:109599674-109599696 CAGGGCCACAAGGAGCAGCTGGG - Intronic
1046670941 8:117055418-117055440 CAGGGACAGCAGCAGTTGCTGGG + Intronic
1049415824 8:142494666-142494688 CAGGGACACCAGGTGCTCTTAGG - Intronic
1052041304 9:23741984-23742006 CTGGGACACAAGGAGTTGCTAGG - Intronic
1053575665 9:39356063-39356085 CAGGGCAGCCAGGGGTTGGTAGG + Intronic
1053840183 9:42184020-42184042 CAGGGCAGCCAGGGGTTGGTAGG + Intronic
1054097235 9:60914768-60914790 CAGGGCAGCCAGGGGTTGGTAGG + Intergenic
1054118641 9:61190397-61190419 CAGGGCAGCCAGGGGTTGGTAGG + Intronic
1054589116 9:66992167-66992189 CAGGGCAGCCAGGGGTTGGTAGG - Intergenic
1055320891 9:75082613-75082635 CAGGGCCACAAGGATTAGCTTGG + Intronic
1055987136 9:82063328-82063350 CAGGGCAGCCAGGGGTTGGTAGG - Intergenic
1056575292 9:87851678-87851700 CATGGGCTCCAGGTGTTGTTTGG + Intergenic
1056583764 9:87914852-87914874 CAGGGCAGCCAGGGGTTGGTAGG + Intergenic
1056584256 9:87918321-87918343 CAGGGCAGCCAGGGGTTGGTAGG + Intergenic
1056612614 9:88134604-88134626 CAGGGCAGCCAGGGGTTGGTAGG - Intergenic
1056613110 9:88138094-88138116 CAGGGCAGCCAGGGGTTGGTAGG - Intergenic
1057160040 9:92882933-92882955 CAGGGCAGCCAGGGGTTGGTAGG + Intergenic
1057581992 9:96295298-96295320 CCGGGCCACAAGGAGTTTTTTGG + Intronic
1057850671 9:98564765-98564787 CTGGGCCTGAAGGAGTTGTTTGG + Intronic
1191658105 X:63621568-63621590 GAGGCCTACCAGGAGGTGTTTGG + Intergenic
1192428777 X:71098894-71098916 CAGGAACACAAGGAGTTCTTTGG + Intronic
1195317288 X:103691510-103691532 CAGGGCCAGCAGAAAATGTTGGG - Intergenic
1195402461 X:104475882-104475904 CAGGGCCTCCAGGCTTGGTTTGG + Intergenic
1198998671 X:142606666-142606688 CAGGTCCACCCGAAGTTGTCCGG - Intergenic
1201748382 Y:17405392-17405414 CAGGACCACCCGCAGTTATTTGG + Intergenic