ID: 964895364

View in Genome Browser
Species Human (GRCh38)
Location 3:161589707-161589729
Sequence CTTTATTAGTAGAGTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964895364_964895369 7 Left 964895364 3:161589707-161589729 CCATTCTCACTCTACTAATAAAG No data
Right 964895369 3:161589737-161589759 CAAGACTGGGTAATTTATAAAGG No data
964895364_964895370 14 Left 964895364 3:161589707-161589729 CCATTCTCACTCTACTAATAAAG No data
Right 964895370 3:161589744-161589766 GGGTAATTTATAAAGGAAAGAGG No data
964895364_964895366 -6 Left 964895364 3:161589707-161589729 CCATTCTCACTCTACTAATAAAG No data
Right 964895366 3:161589724-161589746 ATAAAGACATACCCAAGACTGGG No data
964895364_964895365 -7 Left 964895364 3:161589707-161589729 CCATTCTCACTCTACTAATAAAG No data
Right 964895365 3:161589723-161589745 AATAAAGACATACCCAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964895364 Original CRISPR CTTTATTAGTAGAGTGAGAA TGG (reversed) Intergenic
No off target data available for this crispr