ID: 964896176

View in Genome Browser
Species Human (GRCh38)
Location 3:161598931-161598953
Sequence TAATCCTGCATTTTAGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964896175_964896176 -5 Left 964896175 3:161598913-161598935 CCATATACAGGTGTCAACTAATC No data
Right 964896176 3:161598931-161598953 TAATCCTGCATTTTAGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964896176 Original CRISPR TAATCCTGCATTTTAGCTCC TGG Intergenic
No off target data available for this crispr