ID: 964901222

View in Genome Browser
Species Human (GRCh38)
Location 3:161660898-161660920
Sequence TGAGCTTTCACACCTACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964901222_964901228 9 Left 964901222 3:161660898-161660920 CCCAGAGTAGGTGTGAAAGCTCA No data
Right 964901228 3:161660930-161660952 GCGGTTATGGTGTTTTATGCAGG No data
964901222_964901227 -4 Left 964901222 3:161660898-161660920 CCCAGAGTAGGTGTGAAAGCTCA No data
Right 964901227 3:161660917-161660939 CTCAGCTGTCAGGGCGGTTATGG No data
964901222_964901226 -10 Left 964901222 3:161660898-161660920 CCCAGAGTAGGTGTGAAAGCTCA No data
Right 964901226 3:161660911-161660933 TGAAAGCTCAGCTGTCAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964901222 Original CRISPR TGAGCTTTCACACCTACTCT GGG (reversed) Intergenic