ID: 964901223

View in Genome Browser
Species Human (GRCh38)
Location 3:161660899-161660921
Sequence CTGAGCTTTCACACCTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964901223_964901228 8 Left 964901223 3:161660899-161660921 CCAGAGTAGGTGTGAAAGCTCAG No data
Right 964901228 3:161660930-161660952 GCGGTTATGGTGTTTTATGCAGG No data
964901223_964901227 -5 Left 964901223 3:161660899-161660921 CCAGAGTAGGTGTGAAAGCTCAG No data
Right 964901227 3:161660917-161660939 CTCAGCTGTCAGGGCGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964901223 Original CRISPR CTGAGCTTTCACACCTACTC TGG (reversed) Intergenic