ID: 964901223 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:161660899-161660921 |
| Sequence | CTGAGCTTTCACACCTACTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 964901223_964901228 | 8 | Left | 964901223 | 3:161660899-161660921 | CCAGAGTAGGTGTGAAAGCTCAG | No data | ||
| Right | 964901228 | 3:161660930-161660952 | GCGGTTATGGTGTTTTATGCAGG | No data | ||||
| 964901223_964901227 | -5 | Left | 964901223 | 3:161660899-161660921 | CCAGAGTAGGTGTGAAAGCTCAG | No data | ||
| Right | 964901227 | 3:161660917-161660939 | CTCAGCTGTCAGGGCGGTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 964901223 | Original CRISPR | CTGAGCTTTCACACCTACTC TGG (reversed) | Intergenic | ||