ID: 964901227

View in Genome Browser
Species Human (GRCh38)
Location 3:161660917-161660939
Sequence CTCAGCTGTCAGGGCGGTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964901222_964901227 -4 Left 964901222 3:161660898-161660920 CCCAGAGTAGGTGTGAAAGCTCA No data
Right 964901227 3:161660917-161660939 CTCAGCTGTCAGGGCGGTTATGG No data
964901221_964901227 -3 Left 964901221 3:161660897-161660919 CCCCAGAGTAGGTGTGAAAGCTC No data
Right 964901227 3:161660917-161660939 CTCAGCTGTCAGGGCGGTTATGG No data
964901223_964901227 -5 Left 964901223 3:161660899-161660921 CCAGAGTAGGTGTGAAAGCTCAG No data
Right 964901227 3:161660917-161660939 CTCAGCTGTCAGGGCGGTTATGG No data
964901217_964901227 25 Left 964901217 3:161660869-161660891 CCTGGCCCTCTAATGGGGTGTTG No data
Right 964901227 3:161660917-161660939 CTCAGCTGTCAGGGCGGTTATGG No data
964901219_964901227 19 Left 964901219 3:161660875-161660897 CCTCTAATGGGGTGTTGAATTTC No data
Right 964901227 3:161660917-161660939 CTCAGCTGTCAGGGCGGTTATGG No data
964901218_964901227 20 Left 964901218 3:161660874-161660896 CCCTCTAATGGGGTGTTGAATTT No data
Right 964901227 3:161660917-161660939 CTCAGCTGTCAGGGCGGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964901227 Original CRISPR CTCAGCTGTCAGGGCGGTTA TGG Intergenic