ID: 964901228

View in Genome Browser
Species Human (GRCh38)
Location 3:161660930-161660952
Sequence GCGGTTATGGTGTTTTATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964901223_964901228 8 Left 964901223 3:161660899-161660921 CCAGAGTAGGTGTGAAAGCTCAG No data
Right 964901228 3:161660930-161660952 GCGGTTATGGTGTTTTATGCAGG No data
964901222_964901228 9 Left 964901222 3:161660898-161660920 CCCAGAGTAGGTGTGAAAGCTCA No data
Right 964901228 3:161660930-161660952 GCGGTTATGGTGTTTTATGCAGG No data
964901221_964901228 10 Left 964901221 3:161660897-161660919 CCCCAGAGTAGGTGTGAAAGCTC No data
Right 964901228 3:161660930-161660952 GCGGTTATGGTGTTTTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964901228 Original CRISPR GCGGTTATGGTGTTTTATGC AGG Intergenic