ID: 964904494

View in Genome Browser
Species Human (GRCh38)
Location 3:161702614-161702636
Sequence CAGTTTTACCTCATTCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964904494_964904498 12 Left 964904494 3:161702614-161702636 CCATGCTGAATGAGGTAAAACTG No data
Right 964904498 3:161702649-161702671 GTAAGATCTGGAACATGACAAGG No data
964904494_964904495 0 Left 964904494 3:161702614-161702636 CCATGCTGAATGAGGTAAAACTG No data
Right 964904495 3:161702637-161702659 AAAGCCTTTCCTGTAAGATCTGG 0: 22
1: 363
2: 1007
3: 1329
4: 1793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964904494 Original CRISPR CAGTTTTACCTCATTCAGCA TGG (reversed) Intergenic
No off target data available for this crispr