ID: 964904495

View in Genome Browser
Species Human (GRCh38)
Location 3:161702637-161702659
Sequence AAAGCCTTTCCTGTAAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4514
Summary {0: 22, 1: 363, 2: 1007, 3: 1329, 4: 1793}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964904492_964904495 12 Left 964904492 3:161702602-161702624 CCTCAGCTAGTGCCATGCTGAAT No data
Right 964904495 3:161702637-161702659 AAAGCCTTTCCTGTAAGATCTGG 0: 22
1: 363
2: 1007
3: 1329
4: 1793
964904490_964904495 27 Left 964904490 3:161702587-161702609 CCATAAATGACAGACCCTCAGCT No data
Right 964904495 3:161702637-161702659 AAAGCCTTTCCTGTAAGATCTGG 0: 22
1: 363
2: 1007
3: 1329
4: 1793
964904491_964904495 13 Left 964904491 3:161702601-161702623 CCCTCAGCTAGTGCCATGCTGAA No data
Right 964904495 3:161702637-161702659 AAAGCCTTTCCTGTAAGATCTGG 0: 22
1: 363
2: 1007
3: 1329
4: 1793
964904494_964904495 0 Left 964904494 3:161702614-161702636 CCATGCTGAATGAGGTAAAACTG No data
Right 964904495 3:161702637-161702659 AAAGCCTTTCCTGTAAGATCTGG 0: 22
1: 363
2: 1007
3: 1329
4: 1793

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964904495 Original CRISPR AAAGCCTTTCCTGTAAGATC TGG Intergenic
Too many off-targets to display for this crispr