ID: 964904498

View in Genome Browser
Species Human (GRCh38)
Location 3:161702649-161702671
Sequence GTAAGATCTGGAACATGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964904491_964904498 25 Left 964904491 3:161702601-161702623 CCCTCAGCTAGTGCCATGCTGAA No data
Right 964904498 3:161702649-161702671 GTAAGATCTGGAACATGACAAGG No data
964904494_964904498 12 Left 964904494 3:161702614-161702636 CCATGCTGAATGAGGTAAAACTG No data
Right 964904498 3:161702649-161702671 GTAAGATCTGGAACATGACAAGG No data
964904492_964904498 24 Left 964904492 3:161702602-161702624 CCTCAGCTAGTGCCATGCTGAAT No data
Right 964904498 3:161702649-161702671 GTAAGATCTGGAACATGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964904498 Original CRISPR GTAAGATCTGGAACATGACA AGG Intergenic
No off target data available for this crispr