ID: 964912431

View in Genome Browser
Species Human (GRCh38)
Location 3:161799547-161799569
Sequence ATAGTCTAGTAGAAGTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964912431_964912434 -10 Left 964912431 3:161799547-161799569 CCTTCCCACTTCTACTAGACTAT No data
Right 964912434 3:161799560-161799582 ACTAGACTATAAGCTCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964912431 Original CRISPR ATAGTCTAGTAGAAGTGGGA AGG (reversed) Intergenic
No off target data available for this crispr