ID: 964912434

View in Genome Browser
Species Human (GRCh38)
Location 3:161799560-161799582
Sequence ACTAGACTATAAGCTCCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964912426_964912434 30 Left 964912426 3:161799507-161799529 CCAGGACAGCAACCATACTACCC No data
Right 964912434 3:161799560-161799582 ACTAGACTATAAGCTCCATTAGG No data
964912431_964912434 -10 Left 964912431 3:161799547-161799569 CCTTCCCACTTCTACTAGACTAT No data
Right 964912434 3:161799560-161799582 ACTAGACTATAAGCTCCATTAGG No data
964912430_964912434 9 Left 964912430 3:161799528-161799550 CCATGGAGACTTTTTAACTCCTT No data
Right 964912434 3:161799560-161799582 ACTAGACTATAAGCTCCATTAGG No data
964912428_964912434 18 Left 964912428 3:161799519-161799541 CCATACTACCCATGGAGACTTTT No data
Right 964912434 3:161799560-161799582 ACTAGACTATAAGCTCCATTAGG No data
964912429_964912434 10 Left 964912429 3:161799527-161799549 CCCATGGAGACTTTTTAACTCCT No data
Right 964912434 3:161799560-161799582 ACTAGACTATAAGCTCCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964912434 Original CRISPR ACTAGACTATAAGCTCCATT AGG Intergenic
No off target data available for this crispr