ID: 964922538

View in Genome Browser
Species Human (GRCh38)
Location 3:161914818-161914840
Sequence TCCAAGTAAAATCGAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964922538_964922542 20 Left 964922538 3:161914818-161914840 CCAGCAATTCGATTTTACTTGGA No data
Right 964922542 3:161914861-161914883 CTGTGCACCGCAATGCGAAGGGG No data
964922538_964922544 24 Left 964922538 3:161914818-161914840 CCAGCAATTCGATTTTACTTGGA No data
Right 964922544 3:161914865-161914887 GCACCGCAATGCGAAGGGGGAGG No data
964922538_964922540 18 Left 964922538 3:161914818-161914840 CCAGCAATTCGATTTTACTTGGA No data
Right 964922540 3:161914859-161914881 TTCTGTGCACCGCAATGCGAAGG No data
964922538_964922541 19 Left 964922538 3:161914818-161914840 CCAGCAATTCGATTTTACTTGGA No data
Right 964922541 3:161914860-161914882 TCTGTGCACCGCAATGCGAAGGG No data
964922538_964922543 21 Left 964922538 3:161914818-161914840 CCAGCAATTCGATTTTACTTGGA No data
Right 964922543 3:161914862-161914884 TGTGCACCGCAATGCGAAGGGGG No data
964922538_964922546 26 Left 964922538 3:161914818-161914840 CCAGCAATTCGATTTTACTTGGA No data
Right 964922546 3:161914867-161914889 ACCGCAATGCGAAGGGGGAGGGG No data
964922538_964922545 25 Left 964922538 3:161914818-161914840 CCAGCAATTCGATTTTACTTGGA No data
Right 964922545 3:161914866-161914888 CACCGCAATGCGAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964922538 Original CRISPR TCCAAGTAAAATCGAATTGC TGG (reversed) Intergenic
No off target data available for this crispr