ID: 964922545

View in Genome Browser
Species Human (GRCh38)
Location 3:161914866-161914888
Sequence CACCGCAATGCGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964922538_964922545 25 Left 964922538 3:161914818-161914840 CCAGCAATTCGATTTTACTTGGA No data
Right 964922545 3:161914866-161914888 CACCGCAATGCGAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964922545 Original CRISPR CACCGCAATGCGAAGGGGGA GGG Intergenic
No off target data available for this crispr