ID: 964925425

View in Genome Browser
Species Human (GRCh38)
Location 3:161950615-161950637
Sequence CTATAGTTACAGTTTTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964925422_964925425 -3 Left 964925422 3:161950595-161950617 CCATATCAACCTGTTTTTCACTA No data
Right 964925425 3:161950615-161950637 CTATAGTTACAGTTTTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964925425 Original CRISPR CTATAGTTACAGTTTTAGGA TGG Intergenic
No off target data available for this crispr