ID: 964927366

View in Genome Browser
Species Human (GRCh38)
Location 3:161975368-161975390
Sequence TGGGCATCCCTGCACTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964927366_964927376 20 Left 964927366 3:161975368-161975390 CCCTGAAAGTGCAGGGATGCCCA No data
Right 964927376 3:161975411-161975433 CAGCTGCAGCTGTGCCCAGGAGG No data
964927366_964927371 -4 Left 964927366 3:161975368-161975390 CCCTGAAAGTGCAGGGATGCCCA No data
Right 964927371 3:161975387-161975409 CCCAGGTCTGTGACCACGGCTGG No data
964927366_964927377 21 Left 964927366 3:161975368-161975390 CCCTGAAAGTGCAGGGATGCCCA No data
Right 964927377 3:161975412-161975434 AGCTGCAGCTGTGCCCAGGAGGG 0: 9
1: 39
2: 88
3: 209
4: 624
964927366_964927369 -8 Left 964927366 3:161975368-161975390 CCCTGAAAGTGCAGGGATGCCCA No data
Right 964927369 3:161975383-161975405 GATGCCCAGGTCTGTGACCACGG No data
964927366_964927373 -3 Left 964927366 3:161975368-161975390 CCCTGAAAGTGCAGGGATGCCCA No data
Right 964927373 3:161975388-161975410 CCAGGTCTGTGACCACGGCTGGG No data
964927366_964927375 17 Left 964927366 3:161975368-161975390 CCCTGAAAGTGCAGGGATGCCCA No data
Right 964927375 3:161975408-161975430 GGGCAGCTGCAGCTGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964927366 Original CRISPR TGGGCATCCCTGCACTTTCA GGG (reversed) Intergenic
No off target data available for this crispr