ID: 964938433

View in Genome Browser
Species Human (GRCh38)
Location 3:162123677-162123699
Sequence AGTATCTCCCTGGATCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964938433_964938440 22 Left 964938433 3:162123677-162123699 CCTTCTAGATCCAGGGAGATACT No data
Right 964938440 3:162123722-162123744 AGGTTACGTCCCCAGAGCTTTGG No data
964938433_964938436 2 Left 964938433 3:162123677-162123699 CCTTCTAGATCCAGGGAGATACT No data
Right 964938436 3:162123702-162123724 CTCCTAACACTACCCAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964938433 Original CRISPR AGTATCTCCCTGGATCTAGA AGG (reversed) Intergenic
No off target data available for this crispr