ID: 964945622

View in Genome Browser
Species Human (GRCh38)
Location 3:162220207-162220229
Sequence TGGGGTTGTTACAAAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964945614_964945622 26 Left 964945614 3:162220158-162220180 CCTCTTCTGGATTTCCTTCACAA No data
Right 964945622 3:162220207-162220229 TGGGGTTGTTACAAAGCCACTGG No data
964945618_964945622 12 Left 964945618 3:162220172-162220194 CCTTCACAATACAGGGGAGTTTG No data
Right 964945622 3:162220207-162220229 TGGGGTTGTTACAAAGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964945622 Original CRISPR TGGGGTTGTTACAAAGCCAC TGG Intergenic
No off target data available for this crispr