ID: 964948511

View in Genome Browser
Species Human (GRCh38)
Location 3:162257121-162257143
Sequence TCCAGGACTTTTATGGTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964948507_964948511 3 Left 964948507 3:162257095-162257117 CCAAAATGATATTTCCTAGGTTT No data
Right 964948511 3:162257121-162257143 TCCAGGACTTTTATGGTTTTAGG No data
964948505_964948511 10 Left 964948505 3:162257088-162257110 CCTATGTCCAAAATGATATTTCC No data
Right 964948511 3:162257121-162257143 TCCAGGACTTTTATGGTTTTAGG No data
964948504_964948511 16 Left 964948504 3:162257082-162257104 CCTGGTCCTATGTCCAAAATGAT No data
Right 964948511 3:162257121-162257143 TCCAGGACTTTTATGGTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964948511 Original CRISPR TCCAGGACTTTTATGGTTTT AGG Intergenic
No off target data available for this crispr