ID: 964949589

View in Genome Browser
Species Human (GRCh38)
Location 3:162273480-162273502
Sequence TTCTCTAAAGGTCTATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964949589_964949593 1 Left 964949589 3:162273480-162273502 CCTTCAAATAGACCTTTAGAGAA No data
Right 964949593 3:162273504-162273526 GTCTAAGTGGACAATAAGCAGGG No data
964949589_964949592 0 Left 964949589 3:162273480-162273502 CCTTCAAATAGACCTTTAGAGAA No data
Right 964949592 3:162273503-162273525 AGTCTAAGTGGACAATAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964949589 Original CRISPR TTCTCTAAAGGTCTATTTGA AGG (reversed) Intergenic
No off target data available for this crispr